a robust adaptive nonlinear control approach to missile autopilot design

Báo cáo hóa học: " A Robust Color Object Analysis Approach to Efficient Image Retrieval" pdf

Báo cáo hóa học: " A Robust Color Object Analysis Approach to Efficient Image Retrieval" pdf

... similar histograms can have dramatically different appearance The inaccuracy raised in the color histogram approach is caused by the total loss of spatial information of pixels in the images To attempt ... example, art image database or medical image database It has been shown that for a general domain, the retrieval accuracy of these approaches are weak In addition, these approaches are restricted ... are now available to address general purposed CBIR The approaches based on these techniques can be basically classified into two categories [2, 3]: global-feature-based approach and region-feature-based...

Ngày tải lên: 23/06/2014, 01:20

15 352 0
báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

... algorithm are used to drive a neural controller which activates a biomechanical model of a simulated human arm and controls the FES To this purpose, and according to [36], a second ANN (ANN2 in ... Delhi: Macmillan India; 2006 Kurosawa K, Futami R, Watanabe T, Hoshimiya N: Joint angle control by FES using a feedback error learning controller IEEE Transactions on Neural Systems and Rehabilitation ... stimulation, necessary to assist a goal-oriented planar movement of one upper limb, is controlled by a biologically inspired neural controller, a HMI and a healthy arm motion detector Four main...

Ngày tải lên: 19/06/2014, 10:20

12 559 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35

2 526 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... to write a good sentence, how to join good sentences into a good paragraph to how to connect paragraphs into a good essay, their last product Not all learners can write a good essay as soon as ... supposed to pay attention to three key factors: Motivation, Rhetorical patterns, and Coherence It is mainly mentioned that a teaching approach to essay writing for Vietnamese learners focuses on a rhetorical ... an art that writers want to communicate with certain groups of audience Essay writing is like academic writing but a special skill that does not spring naturally from an ability to speak a language...

Ngày tải lên: 06/11/2012, 10:35

48 603 1
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to ... need to learn from other sources WRITING PAPER Name: Group A Paper: 02F6g Task: 02 AD Write: It’s said that parents are always the best teachers but we strongly disagree with the above statement ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper:...

Ngày tải lên: 06/11/2012, 10:35

4 480 0
The Capacity Development Results Framework - A strategic and results-oriented approach to learning for capacity development potx

The Capacity Development Results Framework - A strategic and results-oriented approach to learning for capacity development potx

... translate into operational solutions without standardized indicators that break the factors down into observable and measurable units Standard indicators for each capacity factor, adaptable to contexts ... indicators‖ are therefore the primary operational targets of any capacity development program The capacity indicators are measurable, so as to permit analysis and benchmarking The capacity indicators ... Capacity Development Results Framework A strategic and results-oriented approach to learning for capacity development Samuel Otoo, Natalia Agapitova and Joy Behrens June 2009 Abstract The Capacity...

Ngày tải lên: 30/03/2014, 01:20

100 494 0
Báo cáo hóa học: "A Two-Step Hydrothermal Synthesis Approach to Monodispersed Colloidal Carbon Spheres" pdf

Báo cáo hóa học: "A Two-Step Hydrothermal Synthesis Approach to Monodispersed Colloidal Carbon Spheres" pdf

... hydrothermal approach have a hydrophilic surface covered with C–OH groups , which are available for further surface functional modification, as well as the CCS can be easily removed by oxidation at high ... the sealed autoclave was heated to 180 °C for h along with constant stirring at *800 rpm, and then cooled to room temperature naturally Finally, the suspension containing the as-prepared carbon ... processes: a two-step approach and b one-step approach Fig FT-IR spectrum of the CCS prepared by different processes: a one-step approach and b two-step approach monomers onto the colloidal seed surface...

Ngày tải lên: 21/06/2014, 20:20

6 269 0
Báo cáo hóa học: " Research Article A Combined PMHT and IMM Approach to Multiple-Point Target Tracking in Infrared Image Sequence" pdf

Báo cáo hóa học: " Research Article A Combined PMHT and IMM Approach to Multiple-Point Target Tracking in Infrared Image Sequence" pdf

... and Data Association, Academic Press, San Diego, Calif, USA, 1988 [2] S Blackman and R Popoli, Design and Analysis of Modern Tracking Systems, Artech House, Boston, Mass, USA, 1999 [3] J B Pearson ... used to compute a combined state estimate and error covariance matrix for each target, and to predict, forward to the next scan, the collection of states for each target based on a fixed transition ... observations This centroid is then used to update the target’s state and to evaluate model probabilities It is important Mukesh A Zaveri et al to note that it does not assign any particular observation...

Ngày tải lên: 22/06/2014, 19:20

14 568 0
A real time optimal control approach for water quality and quantity management  marina reservoir case study

A real time optimal control approach for water quality and quantity management marina reservoir case study

... ϕ Calibration parameters a Inflow into a reservoir A Green roof surface area c Constant C Salinity concentration Ea Actual evapotranspiration Ep Potential evapotranspiration ET Evapotranspiration ... non-linear relationships a data driven approach is most suitable, and in a data driven approach the emulator is identified based on a data set of input-output samples generated with the physically-based ... integrated approaches (Saito et al 2012) Indeed, the conventional approach to storm water management, which is aimed at maximising the drainage efficiency, has been debated since long as it affects...

Ngày tải lên: 12/09/2015, 21:24

158 362 0
An innovative approach to the aesthetic design pdf

An innovative approach to the aesthetic design pdf

... method to product design, Design studies, Vol 19, No 3, London, Elsevier Science Ltd Ishihara S., K Tsuchiya, M Nagamachi, Y Matsubara,1997, Neural Networks approach to Kansei analysis on canned ... derivative increases are necessarily perceived as accelerating curves Moreover, different shapes may be perceived as having the same property value This means that several characteristics/variables ... are normally judged in a planar view (paper or CAD screen) Nevertheless, since the final aim is always to change the 3D model, the modification has to be propagated to the related surfaces For...

Ngày tải lên: 16/03/2014, 18:20

12 348 0
An approach to collaborative assembly design modification and assembly planning

An approach to collaborative assembly design modification and assembly planning

... Generally the AI-based approaches can be further divided into two main areas: knowledge-based approach and GA-based approach Knowledge-based assembly planning approach generally uses relevant ... the design stage The research works in assembly planning can be divided into two main categories: graph-based approach and artificial intelligence (AI-) based approach 2.3.1 Graph-based approach ... a collaborative assembly planning approach is proposed based on the aforementioned GA-based assembly planning approach It enables several planners to carry out the assembly planning collaboratively...

Ngày tải lên: 15/09/2015, 17:09

196 251 0
Báo cáo hóa học: " A Robust Orthogonal Adaptive Approach to SISO Deconvolution" pot

Báo cáo hóa học: " A Robust Orthogonal Adaptive Approach to SISO Deconvolution" pot

... A Robust Orthogonal Adaptive Approach to SISO Deconvolution to nonlinear equalization applications in [4] and presented as a general polynomial equations framework for nominal and robust ... 50 dB Again the performance of the robust adaptive orthogonal designs approaches the totally adaptive FIR, with only to adaptive coefficients 5.4 Remarks The example was developed assuming that the ... EXAMPLE: LINEAR ROBUST ADAPTIVE EQUALIZATION FOR AN ADSL TYPE OF COMMUNICATION CHANNEL The general problem of equalization and particularly adaptive equalization is well described in [28] and a...

Ngày tải lên: 23/06/2014, 01:20

15 246 0
A real time approach to process control  2ed

A real time approach to process control 2ed

... scheme and load variables much as the operator of a plant observes the behaviour of an actual plant Dynamic simulation allows for the comparison of several candidate control strategies and assesses ... leads to a poor valve characteristic and unsatisfactory control For this reason, an equal percentage characteristic should be selected so that the operating characteristic tends towards linear ... that makes it easy to use and learn, yet still be applicable to a broad range of applications and users The criteria include the following: r Easy to use and learn It must have an intuitive and...

Ngày tải lên: 01/01/2014, 17:44

327 548 0
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx

Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx

... forms as the training/evaluation data The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 ... problem, as compared to the generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm ... CVPR’07, pages 1–8 Hong Yu, Won Kim, Vasileios Hatzivassiloglou, and John Wilbur 2006 A large scale, corpus-based approach for automatically disambiguating biomedical abbreviations ACM Transactions...

Ngày tải lên: 17/03/2014, 01:20

9 389 0
a real time approach to process control

a real time approach to process control

... concepts as fundamentals of chemical engineering For undergraduate programs looking to transition away from the traditional mathematical-based approach to a more applied, hands-on approach, this ... batch-type simulation sessions It is imperative that a dynamic simulation is ‘packaged’ in a way that makes it easy to use and learn, yet still be applicable to a broad range of applications and ... A Real-Time Approach to Process Control A Real-Time Approach to Process Control Second Edition William Y Svrcek University of Calgary Calgary, Canada Donald P Mahoney BDMetrics Inc Baltimore,...

Ngày tải lên: 01/04/2014, 10:58

345 581 0
Báo cáo hóa học: " Research Article A Robust Approach to Segment Desired Object Based on Salient Colors" pot

Báo cáo hóa học: " Research Article A Robust Approach to Segment Desired Object Based on Salient Colors" pot

... shift: a robust approach toward feature space analysis,” IEEE Transactions on Pattern Analysis and Machine Intelligence, vol 24, no 5, pp 603–619, 2002 [8] G Heidemann, “Region saliency as a measure ... sequence We are confronted to an J Da Rugna and H Konik Table 1: Comparative results KM versus ooKM obtained with oriented approaches with test sequences Average values and standard deviations are given ... on small values for these criteria and also on low variances favorable to a good stability 2.3 Object oriented K-means algorithm This classical clustering process is based on an iterative algorithm:...

Ngày tải lên: 22/06/2014, 19:20

11 321 0
robust adaptive model predictive control of nonlinear systems

robust adaptive model predictive control of nonlinear systems

... computational complexity and conservativeness of the control remains a serious problem In the more general control literature, adaptive control has evolved as an alternative to a robust- control paradigm ... identification of the unknown θ, such that the adaptive controller design is tractable 13.2 Adaptive Robust Controller Design Framework 13.2.1 Adaptation of Parametric Uncertainty Sets Unlike standard ... are explicitly minimized using a robust MPC approach As a result, it is possible to address both state and input constraints within the adaptive framework Another key advantage of this approach...

Ngày tải lên: 27/07/2014, 23:44

35 236 0
Báo cáo y học: " Inhibition of lung serine proteases in mice: a potentially new approach to control influenza infection" doc

Báo cáo y học: " Inhibition of lung serine proteases in mice: a potentially new approach to control influenza infection" doc

... Gzma CGTCGTGATCCCCACTTACT TGATGTGAAACCAGGAACCA AACACACAGGGTTTGCCTTC ATGCCTCGCAAAATACCATC 52 50 Gzmb GACCCAGCAAGTCATCCCTA CACACTCCCGATCCTTCTGT 54 Gzmc CCAGGGGATGAGTGCTATGT ATCCATCAGTTTGCCCGTAG ... GGTCACACTGTCTCCCCACT TGATGGGAGCTGGTTTCAAT ACTTTGGCCTCCTGAAGGTT TCATCAGGGCATAGGACACA 52 50 Elane GGCTTTGACCCATCACAACT CGGCACATGTTAGTCACCAC 52 Ctrl CCCATTGCCTCAGCAACTAT CCAGCCTGTGACATAGCAGA 52 ... Gzmg CATTCCCCATCCAGCTTTTA GATCTGCGTGGTCTTGGAAT 50 Gzmk CCGTGGTTTTAGGAGCACAT CAGGGTATCAGAGGCGGTTA 52 Actb GTCCCTCACCCTCCCAAAAG GCTGCCTCAACACCTCAACCC 55 Gapdh GGTGAAGGTCGGTGTGAACG CTCGCTCCTGGAAGATGGTG...

Ngày tải lên: 11/08/2014, 21:21

15 431 0
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt

Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt

... Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, analysis and ... Inácio Filomena Falcão Gra a Castelo-Branco Jaime Correia-Sousa João Almeida Fonseca José Costa Trindade José Dias-Pereira José Moreira-Silva Additional material Josefina Rodrigues Additional file ... the manuscript draft, SVM participated in data collection and analysis and reviewed the manuscript, RCC participated in study design, web application design, data analysis and reviewed the manuscript;...

Ngày tải lên: 12/08/2014, 14:20

9 370 0
w