Báo cáo hóa học: " A Low-Complexity Time-Domain MMSE Channel Estimator " ppt

Báo cáo hóa học: " A General Theory for SIR Balancing" ppt

Báo cáo hóa học: " A General Theory for SIR Balancing" ppt

... al- ways guaranteed. It can happen that the infimum C(Γ Q ), as in (7), is not achieved, but approached by max k γ k / SIR k (p) arbitrarily close, so all quantities γ k /SIR k are asymptotically balanced ... μp k ,forallk. This has the advantage that zeros in the power allocations can be admitted. The existence of power allocations p ≥ 0(exclud- ing the trivial all-zero allocation p = 0) will...

Ngày tải lên: 22/06/2014, 22:20

18 449 0
báo cáo hóa học:" A Practical Two Stage MMSE based MIMO detector for Interference Mitigation with Non-Cooperative Interferers" doc

báo cáo hóa học:" A Practical Two Stage MMSE based MIMO detector for Interference Mitigation with Non-Cooperative Interferers" doc

... constant throughout the duration of each trial. 3.1 Rayleigh flat fading channels Rayleigh flat fading channels are the easiest channels to compensate. They con- sist of a single impulse and allow ... R n M ) −1 = W MMSE y M (t) (36) We have shown how this MMSE estimator can be broken down into a two- stage process when ideal channel state information is available. In a real syste...

Ngày tải lên: 20/06/2014, 04:20

34 316 0
Báo cáo hóa học: " A Low-Complexity Time-Domain MMSE Channel Estimator " ppt

Báo cáo hóa học: " A Low-Complexity Time-Domain MMSE Channel Estimator " ppt

... wireless channel in the design of a channel estimator, low-order AR models can cap- ture most of the channel tap dynamics and lead to effective estimation techniques. Thus this paper associates channel ... approach. Since the actual channel statistics and SNR may vary within OFDM block, we have also analyzed the effect of modelling mis- match on the estimator performance and show...

Ngày tải lên: 22/06/2014, 23:20

14 144 0
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot

báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot

... bknudsen@fhcrc.org; Sandra Cottingham - sandra.cottingham@spectrum-health.org; Ping Zhao - ping.zhao@vai.org; Karl Dykema - karl.dykema@vai.org; Brian Cao - brian.cao@vai.org; James Resau - james.resau@vai.org; ... material Acknowledgements We are grateful to Drs. David Wenkert and Yuehai Shen for 17AAG char- acterization and to Drs. Jacob Zhang and Kyle Furge for statistical analysis. We t...

Ngày tải lên: 18/06/2014, 15:20

13 413 0
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx

báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx

... Yang H, Wang S, Xie S, Liu Q, Liu T, Huang J, Xie W, Li Z, Zhao Y, Wang E, Marincola FM, Yao K: Tran- scriptional patterns, biomarkers and pathways characteriz- ing nasopharyngeal carcinoma of Southern ... cul- ture and expansion. J Transl Med 2006, 4:40. 37. Maecker HT, Hassler J, Payne JK, Summers A, Comatas K, Ghanayem M, Morse MA, Clay TM, Lyerly HK, Bhatia S, Ghanekar SA, Maino VC, Del...

Ngày tải lên: 18/06/2014, 15:20

10 508 0
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

... 5'- ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA -A) , 5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA- B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT- GCCAATCTCATCTT-3' ... 5'-GGACGTAGGG- TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT- 3' and 5'-AAGACCAGTCCTTGCTGA-3' (β2m), 5'-TAT- AGT...

Ngày tải lên: 18/06/2014, 15:20

13 529 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... 360(9331):427-435. 14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot study of autologous transplantation ... pathological neovascularization. Circ Res 1999, 85(3):221-228. 13. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K,...

Ngày tải lên: 18/06/2014, 15:20

9 775 0
báo cáo hóa học:" A comparison of classification methods for predicting Chronic Fatigue Syndrome based on genetic data" potx

báo cáo hóa học:" A comparison of classification methods for predicting Chronic Fatigue Syndrome based on genetic data" potx

... adopted AUC for evaluating predictive ability of classifiers owing to the fact that AUC is a better performance metric than accuracy [31]. In this study, AUC was used as a value to compare the ... data as testing data and different nine-tenths of the data as training data. Finally, the average estimate over all runs was reported by running the above regular 10-fold cross-validation for 10...

Ngày tải lên: 18/06/2014, 15:20

8 598 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

... sepsis. Intensive Care Med 2001, 27:1412-1415. 24. Martinez A, Orozco G, Varade J, Sanchez LM, Pascual D, Balsa A, Gar- cia A, de la Concha EG, Fernandez-Gutierrez B, Martin J, Urcelay E: Macrophage migration ... malarial anemia. J Infect Dis 2009, 200:629-637. 36. Dhanantwari P, Nadaraj S, Kenessey A, Chowdhury D, Al-Abed Y, Miller EJ, Ojamaa K: Macrophage migration inhibitory factor ind...

Ngày tải lên: 18/06/2014, 15:20

8 555 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al. ... (’5to3’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaa...

Ngày tải lên: 18/06/2014, 16:20

9 568 0
w