Báo cáo hóa học: " Design and Characterization of a 5 2 GHz/2 4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... 20 06, Article ID 48 489, Pages 1–11 DOI 10.1 155 /WCN /20 06 /48 489 Design and Characterization of a 5. 2 GHz /2. 4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Per formance John W. M. ... 4. 1 4. 3 GHz band. The square dots are the simulated data. Tabl e 2: Comparison of measured and simulated phase noise. Frequency band Simulate...

Ngày tải lên: 22/06/2014, 22:20

11 417 0
Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

... Wilkins; 20 01:1 747 -17 85. 8. Malherbe HH, Strickland-Cholmley M: Simian virus SA11 and the related O agent. Arch Gesamte Virusforsch 1967, 22 :2 35- 2 45 . 9. Lopez S, Arias CF: Simian rotavirus SA11 strains. ... antigenic characterization of a serotype G6 human rotavirus isolated in Melbourne, Australia. J Med Virol 19 95, 47 : 348 - 3 54 . 36. Woods PA, Gentsch J, Gouvea...

Ngày tải lên: 20/06/2014, 01:20

8 530 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... carcinomas [21 - 25 ] , 25 - 50% express PR [21 ,23 -26 ], and 45 % expressed both [23 , 25 ] . AR is expressed in 50 -70% of ovarian carcino- mas [ 24 ,26 ]. Accordingly, in th e appropriate clinical and pathologic ... 20 08, 110 :59 - 65. 37. Balachandran R, Welsh MJ, Day BW: Altered levels and regulation of stathmin in paclitaxel-resistant ovarian cancer cells. Oncogene 20...

Ngày tải lên: 20/06/2014, 07:20

8 441 0
Báo cáo hóa học: "Design and implementation of a real time and train less eye state recognition system" docx

Báo cáo hóa học: "Design and implementation of a real time and train less eye state recognition system" docx

... data 0 s0 s1 1 2 20 20 20 20 20 20 20 20 20 15 (a) PVC_F S_ADDRESS1 clr INC comp4 a a>=b b 7'd9 a& lt;b comp6 a a<=b b 7'd 1 35 a& gt;b SMS0 SMS1 S_ADDRESS2 clr INC comp7 a a<=b a& gt;b 7'd 126 b Q Q SET CLR D ... Research Submission date 22 May 20 11 Acceptance date 15 February 20 12 Publication date 15 February 20 12 Article U...

Ngày tải lên: 21/06/2014, 19:20

28 447 0
Báo cáo hóa học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" pdf

Báo cáo hóa học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" pdf

... P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10 and are represented in all panels as 5P1, 10P1, 5P2 and 10P2. In these experiments the YF17D/E200-T3 virus was used as ... Samanta M Mello 1 , Gisela F Trindade 1 , Aymara A Rangel 2 , Adriana S Duarte 1 , Prisciliana J Oliveira 1 , Marcos S Freire 2 , Claire F Kubelka 3 and Ricardo Galler 2 Ad...

Ngày tải lên: 20/06/2014, 01:20

16 422 0
Báo cáo hóa học: " Construction and characterization of an infectious clone of coxsackievirus A16" ppt

Báo cáo hóa học: " Construction and characterization of an infectious clone of coxsackievirus A16" ppt

... CTACGCTCTAGAAAGAAGGA Xba I CV (43 81– 741 0) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV (43 81– 741 0) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG Xho I CV(6087- 741 0-pA) amplification P6 TATGCGGCCGCTTTTTTTTTTTTTTTTTTTTTTTTT ... CV(6087- 741 0-pA) amplification P7 CTAAAGCTTAGCTAATACGACTCACTATAGTTAAAA CAGCCTGTGGGTTG Hind III T7 promoter introduction/priming cDNA syn...

Ngày tải lên: 20/06/2014, 01:20

22 416 0
Báo cáo hóa học: " Isolation and characterization of cidofovir resistant vaccinia viruses" pot

Báo cáo hóa học: " Isolation and characterization of cidofovir resistant vaccinia viruses" pot

... 9 .2 54 ± 2. 9 - - CDV R 1A 122 ± 69 >317 ± 0 7 >6 CDV R 1 5A 98 ± 55 21 4 ± 17 5 4 CDV R 1 6A 49 ± 4 .5 199 ± 2. 8 3 4 a Values are the mean ± standard deviation of two or more assays. Table ... well as DNA downstream of E9L into E6 (primers 5& apos;-TACGATGTTG- TAAAGTGTACGAAGCG-3'; 5& apos;-AGTTAGAGAAATGACGT- TCATCGGTG-3'). The 5& apos; port...

Ngày tải lên: 20/06/2014, 01:20

8 325 0
Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf

Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf

... BL -5 [AF 527 037], Malaysia; BL -5/ P90 [AY 150 576 ], Malaysia; Isolate 7 04 [U 6 54 14] , Aus- tralia; CIA-1 [L 147 67 ], USA; ConnB [U6 9 54 8], USA; Del- Ros [AF31 347 0 ], USA; 26 P4 [D10068], USA; China [AF 448 446 ]; ... China [AF 448 446 ]; A2 -[AB03 129 6], Japan; BD-3 [AF3 951 14] , Bangladesh; CAV -A [AY583 755 ], India; CAV-B [AY583 756 ], India; NIE/19. 04/ 118 [AJ88 8...

Ngày tải lên: 20/06/2014, 01:20

11 390 0
báo cáo hóa học:" Detection and characterization of translational research in cancer and cardiovascular medicine" potx

báo cáo hóa học:" Detection and characterization of translational research in cancer and cardiovascular medicine" potx

... reponderance of clinical articles and journals in the car diac liter ature: clinical journals dominate a larger area of the cardiac map than the cancer map. Of the 75 most active cardiac journals, a ... 1998, Libby 20 04, Yusuf 20 04, Hansson 20 05) , then hypertension (Dahlof 20 02, Chobanian 20 03, Mancia 20 07), and atrial fibrillation (Haissaguerre 1998, Go 20 01, Pa...

Ngày tải lên: 20/06/2014, 03:20

12 397 0
báo cáo hóa học:" Development and characterization of positively selected brain-adapted SIV" pot

báo cáo hóa học:" Development and characterization of positively selected brain-adapted SIV" pot

... AACTCAGTGCCTACCAGATAA For 2 TGGCATGGTAGGGATAATAGGA For 3 ATAAAAGAGGGGTCTTTGTGCT For 4 AACTGCAGAACCTTGCTATCG For 5 GTTTGATCCAACTCTAGCCTACAC For 6 ATGACAGGGTTAAAAAGAGACAAGA For 7 GAATTGGTTTCTAAATTGGGTAGA For ... GAATTGGTTTCTAAATTGGGTAGA For 8 GAGGCACAAATTCAACAAGAGAAG For 9 CATACAGAAAACAAAATATGGATGA For 10 TCCTGGTCCTGAGGTGTAATCCTG Rev 1 CGCAAGAGTCTCTGTCGCAGAT Rev 2 AG...

Ngày tải lên: 20/06/2014, 04:20

15 426 0
w