Báo cáo hóa học: " Preparation and Characterization of Nano structured Materials from Fly Ash: A Waste from Thermal Power Stations, by High Energy Ball Milling" potx

... Materials from Fly Ash: A Waste from Thermal Power Stations, by High Energy Ball Milling K. Thomas Paul Æ S. K. Satpathy Æ I. Manna Æ K. K. Chakraborty Æ G. B. Nando Received: 27 April 2007 / Accepted: ... conventional materials. The key charac- teristics of nanomaterials are its small size, narrow size distribution, low levels of agglomeration and high di...

Ngày tải lên: 22/06/2014, 18:20

... the analysis of the FTIR spectra. AJ participated in the FTIR measurements and the analysis of the spectra and carried out the analysis of the water contact angles on nanoporous alumina. AK and ... smal- ler amounts of chemicals for a comparable surface coverage. Experimental Preparation of nanoporous and thin film alumina surfaces Both nanoporous and thin film alumina...

Ngày tải lên: 21/06/2014, 01:20

... NANO EXPRESS Open Access Preparation and characterization of carbon nanofluid by a plasma arc nanoparticles synthesis system Tun-Ping Teng 1* , Ching-Min Cheng 1 and Feng-Yi Pai 2 Abstract Heat ... in nanofluids. Powder Technol 2008, 186:145. 21. Ananda Kumar S, Shree Meenakshi K, Narashimhan BRV, Srikanth S, Arthanareeswaran G: Synthesis and characterization of copper n...

Ngày tải lên: 21/06/2014, 04:20

... China Authors’ contributions SZ participated in the materials preparation, data analysis and drafted the manuscript. WW, XX and JZ participated in the sample characterization. FR conceived and ... Spherical Magnetite and Maghemite Nanocages. Nanoscale Res Lett 2009, 4:926. 10. Faraji M, Yamini Y, Rezaee M, Magnetic Nanoparticles: Synthesis, Stabilization, Functionalization, Chara...

Ngày tải lên: 21/06/2014, 06:20

... ethanol (95%), n-hexanol, cyclo- hexane, and acetone were obtained from Tianjin Hengxing Chemical Preparation Company; and TritonX-100 was obtained from Sinopharm Chemical Reagent Company. All chemicals ... showed a maximum. The bifunctional MPQDs prepared under the most optimal parameters have a typical diameter of 35 nm and a satu- ration magnetization of 4.35 emu/g at...

Ngày tải lên: 21/06/2014, 20:20

... biologic sample preparation. Characterization of Bare Gold, MHA Film and Protein Monolayer The contact angles of the bare gold surface and the MHA film were determined to be 58° and 18° (data submitted ... the MHA film and rat anti-human IgG monolayer on gold substrates were fabricated by SAM method and characterized by contact angle measurements, Fig. 5 Binding energy sp...

Ngày tải lên: 22/06/2014, 00:20

... ceramic phases [26–29]. There are numerous references to polyamides from aliphatic dia- mines and aromatic diacids and a far lesser number to polyamides from aromatic diamines and aliphatic diacids [30–38]. ... doi: 10.1007/s00396-007-1768-8 398 Nanoscale Res Lett (2009) 4:391–399 123 NANO EXPRESS Synthesis and Characterization of Aromatic–Aliphatic Polyamide Nanocomposite...

Ngày tải lên: 22/06/2014, 01:20

... 575–599. 36 Barone G, Del Vecchio P, Fessas D, Giancola C & Graziano G (1993) THESEUS: a new software package for the handling and analysis of thermal denaturation data of biological macromolecules. ... fractions were investigated: the soluble fraction (S preparation) and the pelleted fraction, after solubilization and renaturation (see Methods), called IB preparation. The...

Ngày tải lên: 30/03/2014, 15:20

... RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10 and are represented in all panels as 5P1, ... Mello 1 , Gisela F Trindade 1 , Aymara A Rangel 2 , Adriana S Duarte 1 , Prisciliana J Oliveira 1 , Marcos S Freire 2 , Claire F Kubelka 3 and Ricardo Galler 2 Address: 1 Fund...

Ngày tải lên: 20/06/2014, 01:20

... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... equally Abstract Background Coxsackievirus A1 6 (CVA16) is a member of the Enterovirus genus of the Picornaviridae family and it is a major etiological agent of hand, foot, and m...

Ngày tải lên: 20/06/2014, 01:20