Báo cáo nghiên cứu khoa học " Mango Postharvest Manual - Version 1" pptx
Báo cáo nghiên cứu khoa học " Mango Postharvest Manual - Version 1" pptx
... green mango fruit Impact damage of ripe mango fruit CARD Project 05004 VIE Improvement of Vietnamese Postharvest Practices and Supply Chains - July 2007 Postharvest Physiology Training Manual ... fruit) Eg. Mango Non-climacteric Eg. Orange CARD Project 05004 VIE Improvement of Vietnamese Postharvest Practices and Supply Chains - July 2007 Postharvest Physiology T...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Evolution of Evolution of IPM " pptx
... and practice and practice - - Selective exposure. Selective exposure. - - Selective perception. Selective perception. - - Selective attention Selective attention - - Selective retention. Selective ... we have! Carrying out pre Carrying out pre - - test by test by “ “ KAP KAP ” ” survey survey (Knowledge (Knowledge - - Attitude Attitude - - Pr...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS2" pdf
... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Organisation Research Institute of Fruits and Vegetables (RIFAV), ... each of the RIFAV-Hanoi and IAS-HoChiMinh. The aims of this experiment in Year 1 were evaluation of Vietnam’s coir dust in greenhouse systems. • Exp...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS3 " pot
... Media 1 - Sugar cane waste & peanut husk & soybean • Media 2 - Sugar cane waste & peanut husk & peat • Media 3 - Sugar cane waste & peat & volcanic rock • Media 4 - Cocopeat ... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Org...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS6 " pptx
... grown in both mixes (Fig. 2). 0 20000 40000 60000 80000 100000 120000 2-Jul 12-Jul 22-Jul 1-Aug 1 1- Aug 2 1- Aug 3 1- Aug 10-Sep Date of harvest Total water used (ml) Mix 1 Mix 2 Poly. (Mix 1) Poly. ... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Organisa...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " REPORT ON INVESTIGATIONS INTO MANGO SUPPLY CHAINS IN THE MEKONG DELTA VIETNAM 2005-2007 " ppt
... January 2008 Page 33 Mango variety 'Ghep' Thousands ('000) VND / kg <3 3-5 5-1 0 1 0-1 5 1 5-2 0 2 0-2 5 2 5-3 0 >30 Percentage (%) of the total number of mango retaliers surveyed 0 10 20 30 40 50 60 ... the mango cultivar ‘‘Cat Hoa Loc’’ in Ho Chi Minh City, Vietnam Off Season (Mango Cultivar 'Cat Hoa Loc') Thousands ('000) VN...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Cat Hoa Loc Mango Quality Guide " ppt
... improved post-harvest and supply chain management By R. J. Nissen, Nguyen Duy Duc & Dr Nguyen Minh Chau et. al. 2008 Page 31 Class 2 Sub-class A Class 2 Sub-class B Class 2 Sub-class C ... Hoa Loc Mango Variety Cat Chu Mango Variety Buoi / Ghep Mango Variety CARD Project 050/04 VIE “Improvement of export and domestic markets for Vietnamese fruit through improved post-harv...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Fruit Quality Characteristics for Pomelo and Mango to develop quality guides for the Vietnamese pomelo and Mango Industries " docx
... 7 SOFRI Trials on Hot Water Fungicide Treatment of Mango Cat Ho Loc By Mr Do Minh Hien Sap and extraneous matter was removed via washing. Cleaned mango fruit of the cultivar “Cat Hoa Loc” are ... “Cat Hoa Loc” are presented in Figure 1 below. Figure 1. Cleaned Fruit of the Mango cultivar “Cat Hoa Loc Mango Fruit were placed in a hot water fungicide dip of carbendazim for...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học cuối kỳ
... chức năng nghiên cứu : 6 Phân loại theo tính chất của sản phẩm nghiên cứu : 6 LÀM THẾ NÀO ĐỂ NGHIÊN CỨU KHOA HỌC ĐẠT HIỆU QUẢ 8 Trình tự các bước cần tiến hành trong nghiên cứu khoa học 8 Các ... hướng. Nghiên cứu cơ bản định hướng được phân chia thành nghiên cứu nền tảng (background research) và nghiên cứu chuyên đề (thematic research). Nghiên cứu nền...
Ngày tải lên: 17/09/2012, 11:51
Báo cáo nghiên cứu khoa học
... hiện DNA-A của nhiều begomovirus (Ha et al., 2006, 2008) Hai cặp mồi còn lại là các mồi đặc hiệu cho TYLCVNV (TYLCVNV-sp-F 1 / TYLCVNV-sp- R 1 ) và ToLCVV (ToLCVV-sp-F 2 / ToLCVV-sp-R 2 ). ... được sử dụng trong nghiên cứu Mồi Trình tự (5’ – 3’) Vị trí Kích thước (bp) Tham khảo TYLCVNV-Sp- F1 TGTGTTACATATTCTGTGTTTTCC 109 4-1 117 1386 Mã GeneBank DQ641697 TYLCVNV-Sp- R1 AAATACA...
Ngày tải lên: 15/03/2013, 16:34
- báo cáo nghiên cứu khoa học quả quất
- cách trình bày báo cáo nghiên cứu khoa học
- báo cáo nghiên cứu khoa học về kinh tế
- báo cáo nghiên cứu khoa học môi trường
- báo cáo nghiên cứu khoa học giáo dục
- báo cáo nghiên cứu khoa học powerpoint
- báo cáo nghiên cứu khoa học mẫu
- báo cáo nghiên cứu khoa học của sinh viên
- báo cáo nghiên cứu khoa học sinh viên