Báo cáo hóa học: " Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study" docx

... al.: Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study. Nanoscale Research Letters 2011 6:160. Submit your manuscript to a journal and ... by mechanical uni-axial deformation: a DFT study Shin-Pon Ju * , Yao-Chun Wang, Ting-Wei Lien Abstract The effect of uni-axial strain on the elect...

Ngày tải lên: 21/06/2014, 05:20

... assay (forward primer: TTGGTC TTACT- GACATCCACTTTG, reverse primer CAGACACTT TGAAGCCCTCAG, exo-NICD-specific probe [6-FAM] CCCAGTTCAATTACAGCTCTTAAGGCTAGAG [BHQ 1a- 6FAM])). Amplification signals were ... designed the study, performed immunoassays and flow cytometry, analyzed and interpreted data, and wrote the manuscript . CCT partici pated in data analysis and interpretation, performed s...

Ngày tải lên: 19/06/2014, 22:20

... that the SnS nanowires are a good single crystalline. The HRTEM image of a single SnS Fig. 2 SEM images of AAO template and SnS nanowire arrays. a Typical SEM image of AAO template. b and c The ... in a low magnification. d SEM image of a typical cross- section Fig. 3 TEM images of AAO template and SnS nanowire arrays. a The sample was etched for 10 h. b The SnS...

Ngày tải lên: 22/06/2014, 01:20

... USA E-mail address: ganastss@memphis.edu Sorin G. Gal: Department of Mathematics, University of Oradea, Str. Armatei Romane 5, Oradea 410087, Romania E-mail address: galso@uoradea.ro 14 Geometric and approximation ... (0,1]. Acknowledgment This paper was written during the 2005 Spring Semester when the second author was a Visiting Professor at the Department of Mathematical Scie...

Ngày tải lên: 22/06/2014, 21:20

... of the addi- tion was the total disappearance of specific resonances without the concomitant appearance of other signals in other parts of the spectrum. This result could be a consequence of the ... protein ratio, the resonances of Arg20, Asp22 and Asp23 disap- peared, and the resonance of Leu21 shifted. At a 2 : 1 ratio, the resonances of residues 19 and 44...

Ngày tải lên: 18/02/2014, 16:20

... decorated with stain, as well as clustered deposits of fibrils with an average diameter of 6 nm (Fig. 6C). FX1RP Nt-NES aggregates have a curved appearance, with an apparent average diameter of 10 nm ... (2010) Sam68 sequestration and partial loss of function are associated with splicing alterations in FXTAS patients. EMBO J 29, 1248–1261. 37 Garcia-Arocena D & Hagerman PJ (2010)...

Ngày tải lên: 14/03/2014, 23:20

... I. The reason is that the size of a grammar for the inverse homomorphic image of a language need only be polynomiaUy bigger than the size of a grammar for the language itself. The proof of ... proportional to n such that the instance has a vertex cover if and only if the string is generated by the grammar. He also notes that if all ID/LP grammars have f...

Ngày tải lên: 17/03/2014, 20:20

... 5-GATGACGAGCTCGACAAATGGGCGAAGGAAACGCTGCAAAAGGAC 64-43-ELD-SacI-for 5-GATGACGAGCTCGGGCGGGGTAATGTCCAAG 64-59-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGTACAACGAAAACGTGATTATCGG 64-59-ELD-SacI-for 5-GATGACGAGCTCGTCCGTCTCCACGATGGTG 64-148-ELD-SacI-back ... 5-GATGACGAGCTCGACAAATGGGCGACGGACGAGTGCCAGGTATAC 64-180-ELD-SacI-for 5-GATGACGAGCTCGTCGTCCTGGCACTCGAGC 64-234-ELD-SacI-back 5-GATGACGAGCTCGACAAATGG...

Ngày tải lên: 23/03/2014, 21:21

... (or Wilcoxon rank- sum test), the analysis of variance (ANOVA) test (or Kruskal-Wallis test), and the Spearman-rank correlation coefficient, as appropriate. For the analysis of histopatho- logic ... oversaw its design and coordination, supervised the analysis and interpretation of the data, and writing the manuscript. All authors read and approved the final man- uscript. A...

Ngày tải lên: 18/06/2014, 15:20

Ngày tải lên: 18/06/2014, 16:20