Báo cáo hóa học: " Hybrid FIB milling strategy for the fabrication of plasmonic nanostructures on semiconductor substrates" potx

báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx

báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx

... completes the proof of Theorem 2.  4. Smoothness of the intersection local time In this section, we consider the smoothness of the intersection local time. Our main object is to explain and prove the ... + 1 2 u 2 |ξ| 2 Var  S H,1 t −  S H,1 s   for all t, s ≥ 0. 3. Existence of the intersection local time The aim of this section is to pro...
Ngày tải lên : 18/06/2014, 15:20
  • 21
  • 532
  • 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf

báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf

... this article as: Sakkalis et al., A decision support framework for the dis- crimination of children with controlled epilepsy based on EEG analysis Jour- nal of NeuroEngineering and Rehabilitation ... classi- fication accuracies and statistical distributions of bio- markers. The results of this paper indicate that univariate Wave- let analysis, as well as bi...
Ngày tải lên : 19/06/2014, 08:20
  • 14
  • 454
  • 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... CATGATCAACTGCTCTGATTAC 1741(+) GGGCTTCCCGTACTTTGTG 2321(+) TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nM Ty 2339- AACATTCAGGGAGCTAAATCCAG ... (A) in the multiple cloning site of the vector pGreen. (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI Sac...
Ngày tải lên : 20/06/2014, 01:20
  • 10
  • 396
  • 0
báo cáo hóa học:" An integrated psychological strategy for advanced colorectal cancer patients" ppt

báo cáo hóa học:" An integrated psychological strategy for advanced colorectal cancer patients" ppt

... morbidity and its recognition by doctors in patients with cancer. Br J Cancer 2001, 84:1011-1015. 24. Levi F: Circadian chronotherapy for human cancers. Lancet Oncol 2001, 2:307-315. 25. Levi F, Zidani ... number not for citation purposes) Health and Quality of Life Outcomes Open Access Research An integrated psychological strategy for advanced colorectal cancer patien...
Ngày tải lên : 20/06/2014, 15:20
  • 9
  • 381
  • 0
Báo cáo hóa học: " Hybrid FIB milling strategy for the fabrication of plasmonic nanostructures on semiconductor substrates" potx

Báo cáo hóa học: " Hybrid FIB milling strategy for the fabrication of plasmonic nanostructures on semiconductor substrates" potx

... 6:572 http://www.nanoscalereslett.com/content/6/1/572 Page 2 of 5 NANO EXPRESS Open Access Hybrid FIB milling strategy for the fabrication of plasmonic nanostructures on semiconductor substrates Joshua F ... spatial resolution. The use of reduced acceleration voltages is shown to reduce the damage from higher energy ions on the example of fabrication o...
Ngày tải lên : 20/06/2014, 22:20
  • 5
  • 500
  • 1
Báo cáo hóa học: " Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions Guangjun Shen" pptx

Báo cáo hóa học: " Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions Guangjun Shen" pptx

... completes the proof of Theorem 2. □ 4. Smoothness of the intersection local time In this section, we consider the smoothness of the intersectio n local time. Our main object is to explain and prove the ... (1973) doi:10.1186/1029-242X-2011-139 Cite this article as: Shen: Necessary and sufficient condition for the smoothness of intersection loc...
Ngày tải lên : 20/06/2014, 23:20
  • 16
  • 406
  • 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

... introduce and to analyze the performance of different array receivers for the detection of a known signal, with different sets of unknown parameters, corrupted by an unknown noncircular total noise. ... sets of unknown signal parameters, for the detection of a known signal corrupted by an unknown SO noncircular total noise. To simp...
Ngày tải lên : 21/06/2014, 00:20
  • 45
  • 467
  • 0
Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot

Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot

... spatial and temporal artifacts. In the case of binary halftone videos produced from grayscale continuous-tone videos, there are two key temporal artifacts. These temporal artifacts are flicker and ... Article ID 625191, 11 pages doi:10.1155/2010/625191 Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binar...
Ngày tải lên : 21/06/2014, 08:20
  • 11
  • 519
  • 0
Báo cáo hóa học: " Research Article Motion Segmentation for Time-Varying Mesh Sequences Based on Spherical Registration" potx

Báo cáo hóa học: " Research Article Motion Segmentation for Time-Varying Mesh Sequences Based on Spherical Registration" potx

... more computationally demanding than the motion segmentation, which requires to conduct ICP with only a few neighboring frames. Although the methods for motion segmentation and motion retrieval ... Similarity among motion clips. high computational cost is a problem to be solved in the future work. 5. Conclusions In this paper, a very robust motion segmentation and motion ret...
Ngày tải lên : 21/06/2014, 22:20
  • 9
  • 293
  • 0
Báo cáo hóa học: "Various Quantum- and Nano-Structures by III–V Droplet Epitaxy on GaAs Substrates" potx

Báo cáo hóa học: "Various Quantum- and Nano-Structures by III–V Droplet Epitaxy on GaAs Substrates" potx

... diffusion, and surface reconstruction. Keywords Droplet epitaxy Á Nanostructures Á High-index GaAs Á Atomic force microscope Á Molecular beam epitaxy Introduction Owing to their unique optoelectronic, ... nanostructures fabricated on GaAs (100) by DE at (a) 250, (b) 350, and (c) 450°C. The growth condition was similar to that used in samples in Fig. 2 except the T sub for th...
Ngày tải lên : 22/06/2014, 00:20
  • 7
  • 280
  • 0
Báo cáo hóa học: " Double In Situ Approach for the Preparation of Polymer Nanocomposite with Multi-functionality" potx

Báo cáo hóa học: " Double In Situ Approach for the Preparation of Polymer Nanocomposite with Multi-functionality" potx

... been no reports of a double in situ approach for the preparation of functional polymer nano- composites. In this communication, a new double in situ approach for the preparation of PET/titanium ... new approach is of general significance in the preparation of polymer nanocomposites, and will lead to a new route in the synthesis of multi...
Ngày tải lên : 22/06/2014, 01:20
  • 4
  • 448
  • 0
Báo cáo hóa học: " Research Article Dynamical Properties for a Class of Fourth-Order Nonlinear Difference Equations" potx

Báo cáo hóa học: " Research Article Dynamical Properties for a Class of Fourth-Order Nonlinear Difference Equations" potx

... x v n−1 x k n−2 x j n−3  . 3.10 Hindawi Publishing Corporation Advances in Difference Equations Volume 2008, Article ID 678402, 13 pages doi:10.1155/2008/678402 Research Article Dynamical Properties for a Class of Fourth-Order Nonlinear ... “Qualitative properties for a fourth-order rational difference equation,” Journal of Mathematical Analysis and Applicatio...
Ngày tải lên : 22/06/2014, 06:20
  • 13
  • 287
  • 0
Báo cáo hóa học: " Research Article WKB Estimates for 2 × 2 Linear Dynamic Systems on Time Scales" potx

Báo cáo hóa học: " Research Article WKB Estimates for 2 × 2 Linear Dynamic Systems on Time Scales" potx

... 1 .21  and 1 .22 .Notethat ζ 0 − a 11 a 12  a 22 − a 11 2a 12  λ, ζ 0− − a 11 a 12  a 22 − a 11 2a 12 − λ, ζ 1 − ζ 1−  a 12 μλ Δ  2  μTrA 2  a 11 − a 22 2a 12  Δ . 2. 32 Furthermore ... pages doi:10.1155 /20 08/7 129 13 Research Article WKB Estimates for 2 2 Linear Dynamic Systems on Time Scales Gro Hovhannisyan Kent State Universit...
Ngày tải lên : 22/06/2014, 11:20
  • 12
  • 179
  • 0
Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

... IV-361–IV-364, Bangkok, Thailand, May 2003. [9] A. Hocanin and O. Kukrer, “Estimation of the frequency and waveform of a single-tone sinusoid using an offline-optimized adaptive filter,” in Proceedings of IEEE ... Signal Processing Volume 2006, Article ID 38190, Pages 1–10 DOI 10.1155/ASP/2006/38190 An FIR Notch Filter for Adaptive Filtering of a Sinusoid in...
Ngày tải lên : 22/06/2014, 23:20
  • 10
  • 452
  • 0
Báo cáo hóa học: " Research Article Accurate Methods for Signal Processing of Distorted Waveforms in Power Systems" potx

Báo cáo hóa học: " Research Article Accurate Methods for Signal Processing of Distorted Waveforms in Power Systems" potx

... on Advances in Signal Processing Volume 2007, Article ID 92191, 14 pages doi:10.1155/2007/92191 Research Article Accurate Methods for Signal Processing of Distorted Waveforms in Power Systems A. ... A. Testa, “On some advanced methods for waveform distortion assessment in presence of interharmonics,” in Proceedings of IEEE Power En- gineering Soci...
Ngày tải lên : 22/06/2014, 23:20
  • 14
  • 328
  • 0

Xem thêm