Báo cáo hóa học: " A simple route to vertical array of quasi-1D ZnO nanofilms on FTO surfaces: 1D-crystal growth of nanoseeds under ammonia-assisted hydrolysis process" pptx
... 6:564 http://www.nanoscalereslett.com/content/6/1/564 Page 7 of 12 NANO EXPRESS Open Access A simple route to vertical array of quasi-1D ZnO nanofilms on FTO surfaces: 1D-crystal growth of nanoseeds under ammonia-assisted hydrolysis process Akrajas ... hydrolysis process Akrajas Ali Umar 1* , Mohd Yusri Abd Rahman 2* , Rika Taslim 2 , Muhamad Mat Sa...
Ngày tải lên: 20/06/2014, 22:20
... performed to measure nonselective longitudinal relaxation rates of protons [79]. In order to measure T 1 values of very fast relaxing protons, INEPT transfer and relaxation delays were shortened to 1.6 ... of 13 C, 15 N-enriched protein. The already available assignment of 1 Hand 15 N resonances [45] was extended to 13 C resonances of backbone and side chains by a combinat...
Ngày tải lên: 08/03/2014, 08:20
... P(C/ A) 1416 Tetsuya Sakai. 200 7a. On the Reliability of Factoid Question Answering Evaluation. ACM Trans. Asian Lang. Inf. Process., 6(1). Tetsuya Sakai. 2007b. On the reliability of information retrieval ... for classification tasks with unbal- anced collections. A comparison of both approaches for Answer Validation evaluation is provided in (Ro- drigo et al., 2011). AVE 2007 c...
Ngày tải lên: 17/03/2014, 00:20
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx
... of consolidating clinical trials results even more daunting. vii. Standardization, Centralization, Validation Although the principles of standardization and validation of assays are the primary ... Disis and Karolina Palucka to evaluate current approaches to the validation of known immune response biomarkers and the standardization of the respective assays to enhance the likel...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " A general solution to the continuous-time estimation problem under widely linear processing" pdf
... estimation of a complex-valued signal on the basis of noisy complex-valued observations under a SL processing. In fact, Cambanis’ s approach is validforanytypeofsecond-order signals and observa- tion ... linear processing Ana Mar a Martínez-Rodríguez, Jesús Navarro-Moreno, Rosa Mar a Fernández-Alcalá * and Juan Carlos Ruiz-Molina Abstract A general problem of continuous-time...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot
... Technology, Thindal, Erode-638 012, Tamil Nadu, India Full list of author information is available at the end of the article Mangai and Tamilarasi EURASIP Journal on Wireless Communications and Networking ... 2011:18 http://jwcn.eurasipjournals.com/content/2011/1/18 Page 6 of 10 RESEARC H Open Access A new approach to geographic routing for location aided cluster based MANETs Sent...
Ngày tải lên: 21/06/2014, 03:20
Báo cáo khoa học: "A SIMPLE BUT USEFUL APPROACH TO CONJUNCT IDENTIFICATION" docx
... conjunctions, and a restructurer. The tagger is a probabilistic program that tags the words in the manual. These tags consist of two parts - a mandatory syntactic portion, and an optional ... exploring the automation of extraction of information from structured reference manuals. The largest manual available to the project in machine-readable form is the Merck Veterinary...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo ... (’ 5to3 ’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaat...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Validated instruments used to measure attitudes of healthcare students and professionals towards patients with physical disability: a systematic review" pdf
... data abstraction, data analysis, and drafting the manuscript. DM and IN contributed to screening. IN contributed to screening. AS contributed to drafting the protocol. EAA contributed to drafting ... instruments to measure attitudes of healthcare students and professionals towards patients with physical disability. Table of the characteristics of Lam et al. Journal of NeuroE...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
... could really have an impact also as a home-rehabilitation treatment for chronic stroke patients. Abbreviations ANOVA: analysis of variance; BF: biofeedback; EMG: electromyography; VOL1: first phase of ... manuscript writing; EA participated to study design, data collection and analysis, and manuscript definition; PR participated at data collection; EG participated at data collection;...
Ngày tải lên: 19/06/2014, 08:20