Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot
Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot
... d at the same chamber using alternating surface-saturating reactions of titanium chlo ride and water. The TiOPDA-TiO 2 nanohybrid thin films that were prepared exhibit good thermal and mechanical ... USA) using A l Ka source run at 15 kV and 10 mA. The binding energy scale was calibrated to 284.5 eV for the main C 1s peak. Each sample was analyzed at a 90° angle relative to th...
Ngày tải lên: 20/06/2014, 21:20
báo cáo hóa học:" Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" ppt
... of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene Kwan-Hyuck Yoon, Kyu-Seok Han and Myung-Mo Sung * Abstract We fabricated a new organic-inorganic ... d at the same chamber using alternating surface-saturating reactions of titanium chlo ride and water. The TiOPDA-TiO 2 nanohybrid thin films...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTG MicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTT...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... gene was amplified by PCR, with chromosomal DNA of M. mazei as template and the following primers: mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The ... Shima S, Netrusov A, Sordel M, Wicke M, Hartmann GC & Thauer RK (1999) Purification, characterization, and primary structure of a monofunctio...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo hóa học: " Research Article A New System of Generalized Nonlinear Mixed Variational Inclusions in Banach Spaces" pot
... of variational inequality problems, were introduced and studied. Pang 1, Cohen and Chaplais 2, Bianchi 3, and Ansari and Yao 4 considered a system of scalar variational inequalities, and Pang ... Mathematicae Debrecen, vol. 54, pp. 267–279, 1999. 8 G. Kassay, J. Kolumb ´ an, and Z. P ´ ales, “Factorization of Minty and Stampacchia variational inequality systems...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx
... Integral means inequalities for fractional derivative We will make use of the following definitions of fractional derivatives by Owa 4,andSrivas- tava and Owa 5. Definition 4.1. The fractional ... comments and suggestions. References 1 F. M. Al-Oboudi, “On univalent functions defined by a generalized S ˘ al ˘ agean operator,” International Journal of Mathematics and Mathemati...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Defined by Generalized Ruscheweyh Differential Operator" potx
... Journal, vol. 18, no. 1, pp. 53–59, 1978. 4 H. M. Srivastava and S. Owa, Eds., Univalent Functions, Fractional Calculus, and Their Applications, Ellis Horwood Series in Mathematics and Its Applications, ... Journal of Inequalities and Applications References 1 K. A. Shaqsi and M. Darus, “On univalent functions with respect to K-symmetric points given by a generalised Rusc...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf
... parameters,” Advances in Mathematics, vol. 38, no. 3, pp. 257–268, 2009. 5 B. C. Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, ... Mitrinovi ´ c, J. E. Pe ˇ cari ´ c,andA.M.Fink,Inequalities Involving Functions and Their Integrals and Derivatives,vol.53ofMathematics and Its Applications (East European Series),K...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS 2837 GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAA GTTATTGAGATCGTCG-3¢, respec- tively ... including a catalytic triad, an a ⁄ b- hydrolase fold and a cofactor independent activity. The catalytic triad usually consists of a nucleophilic serine in a GXSXG pentapeptide m...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo hóa học: " Research Article A New Hybrid Algorithm for a System of Mixed Equilibrium Problems, Fixed Point Problems for Nonexpansive Semigroup, and Variational Inclusion Problem" ppt
... Cholamjiak and S. Suantai, A new hybrid algorithm for variational inclusions, generalized equilibrium problems, and a finite family of quasi-nonexpansive mappings,” Fixed Point Theory and Applications, ... Theory and Applications 9 T. Jitpeera and P. Kumam, “An extra gradient type method for a system of equilibrium problems, variational inequality problems and fixed...
Ngày tải lên: 21/06/2014, 07:20