Accelerate C in FPGA 3 potx

Accelerate C in FPGA_3 potx

Accelerate C in FPGA_3 potx

... overriding it by passing a different CultureInfo instance, such as one obtained by creating a new instance of CultureInfo by passing into its constructor a string representing the desired locale ... types in order to distinguish them from the new collection types and interfaces defined within the System.Collections.Generic and System.Collections.ObjectModel namespaces. Comparing ICollec...

Ngày tải lên: 20/06/2014, 08:20

59 249 0
Accelerate C in FPGA_5 potx

Accelerate C in FPGA_5 potx

... IMyEnumerator<object> collObjects = collStrings; PrintCollection( collObjects, 2 ); } static void PrintCollection( IMyEnumerator<object> coll, int count ) { for( int i = 0; i < count; ... has discussed how to declare and use generics using C# , including generic classes, structs, interfaces, methods, and delegates. I discussed generic constraints, which are nece...

Ngày tải lên: 20/06/2014, 08:20

59 154 0
Accelerate C in FPGA_1 ppt

Accelerate C in FPGA_1 ppt

... main reason for this is so that only the class for the object being copied can call it, because MemberwiseClone can create an object without calling its instance constructor. Such behavior could ... unboxing, which I showed can introduce unintended inefficiencies when you don’t understand all of the places boxing can be introduced by the compiler. (In Chapter 11, which covers generics, ....

Ngày tải lên: 20/06/2014, 08:20

59 212 0
Accelerate C in FPGA_4 pot

Accelerate C in FPGA_4 pot

... System.Collections.Generic; public class EntryPoint { static void Main() { } public void NonGeneric( Stack stack ) { foreach( object o in stack ) { int number = (int) o; Console.WriteLine( ... up a closed instance delegate to an instance method on an object instance, the delegate passes the object instance as the this reference when it calls the instance method. With ope...

Ngày tải lên: 20/06/2014, 08:20

59 183 0
Accelerate C in FPGA_7 pdf

Accelerate C in FPGA_7 pdf

... format: (1.1 234 6 2.1 234 6) DE format: (1,1 234 6 2,1 234 6) Object.ToString(): (1.1 234 5678 2.1 234 5678) In Main, notice the creation and use of two different CultureInfo instances. First, the ComplexNumber ... they’re stored within a container. You’ll notice that core types within the CLR, such as System.Int32, also support interfaces such as IComparable. However, from an efficien...

Ngày tải lên: 20/06/2014, 08:20

59 246 0
Accelerate C in FPGA_8 docx

Accelerate C in FPGA_8 docx

... TCollection collection, TCursor cursor, Func<TCollection, TCursor, TItem> getCurrent, Func<TCursor, bool> isFinished, Func<TCursor, TCursor> advanceCursor) { while( !isFinished(cursor) ... the following: using System; unsafe public class MyClosure { public MyClosure( int* counter ) { this.counter = counter; } public delegate int IncDelegate(); pu...

Ngày tải lên: 20/06/2014, 08:20

59 122 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

... DNA helicase substrate at 37 °Cin30min(1 %in one min). For examining the effect of DNA-interacting compounds on DNA unwinding activity of PDH120, the compounds were added at 50 l M final concentrations ... polypeptide containing the properties of an antibiotic, intercalates into dsDNA and thereby inhibits nucleic acid synthesis [ 23] . Nogalamycin and daunorubicin are anthracycline antibioti...

Ngày tải lên: 20/02/2014, 11:20

11 574 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG -3 and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG -3 . HindIII–BamHI digested PCR product was cloned into the pBlueScript SK- vector and then recloned by Kpn I–BamHI into ... Drosophila genomic DNA using the following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC -3 and 5 ¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA -3 . EcoRI–BamHI digested PCR product was clo...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Tài liệu Đề thi và đáp án tiếng anh trình độ C - Đề 3 potx

Tài liệu Đề thi và đáp án tiếng anh trình độ C - Đề 3 potx

... struck (B) hit (C) knocked (D) smacked 20. I walked away as calmly as I could ________ they thought I was the thief. A A D (A) or else (B) to avoid (C) owing to (D) incase Trình độ C - Bài 3 1. ... stairs ________. (A) hardly (B) in difficulties (C) with difficulty C C (B) nosed (C) handshake (D) bargain 18. a sabbatical year = ________. (A) a year in which one is released fr...

Ngày tải lên: 25/02/2014, 16:20

8 1K 13
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... pGL3b:Prm3abb. (Primer Kin212, 5¢-dGAG A GGTACCGAGCAAGACTCTGTCTC AAA -3 , nucleo- tides )229 to )209). 3. Prm3abc; pGL3b:Prm3abc. (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 , nucleo- tides ... receptor (Prm3) GGTTGT gtagg AGTTCA – Acyl-CoA oxidase A AGGACA a AGGTCA [54] Acyl-CoA oxidase B AGGTAG a AGGTCA [54] Lipoprotein Lipase TGCCCT t TCCCCC [58] Apolipoprotein AII CAACCT t...

Ngày tải lên: 07/03/2014, 21:20

20 432 0
Từ khóa:
w