báo cáo hóa học:" Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using a single approach: the radio-volar double plating technique" pot

... this article as: Jacobi et al.: Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using a single approach: the radio-volar double plating ... Access Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using...

Ngày tải lên: 20/06/2014, 04:20

... interpreting and writing the manuscript. LA participated in performing the experi- ments, interpreting data and writing the paper, MT partic- ipated in analyzing data, and WZR participated in interpreting ... seated and secured in an adjustable, chair with the ankle strapped to the footrest and the thigh and trunk strapped to the chair. The apparatus includ...

Ngày tải lên: 19/06/2014, 10:20

... in the interpretation and revision of the study. JSA helped conceive, analyze and interpret data and assisted in writing the manuscript. All authors read and approved the final manuscript. Authors’ ... as cerebral ischemia, MS, glioma and brain trauma are closely associated with increased production of cyto- kines in the brain. The production of these resulti...

Ngày tải lên: 19/06/2014, 22:20

... symbols are allocated at ±3, ±9, ±15, and ±21. There are no pilot subcarriers close to the edges of the active band. The lack of the pilot subcarriers at the edges of the OFDM symbol may lead to ... exponentials in time) are embedded in each OFDM symbol, and they are separated from infor- mation symbols in the frequency-domain [1-3]. If the channel remains cons...

Ngày tải lên: 21/06/2014, 03:20

... information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about other ... Brownian motion-via chaos expansion. J. Math. Kyoto. Univ. 41:233–250 (2001) [30] Watanabe, S: Stochastic Differential Equations and Malliavin Calculus. Tata Institute of Fundamental Rese...

Ngày tải lên: 18/06/2014, 15:20

... FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaque nucleotide sequence (Genbank Acces- sion ... reverse-5'- GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and rev...

Ngày tải lên: 18/06/2014, 15:20

... Gonzalez I, Dejean S, Martin P, Baccini A: CCA: An R Package to Extend CanonicalCorrelation Analysis. Journal of Statistical Soft- ware 2008, 23(12):1-14. 64. Takakura S, Mitsutake N, Nakashima ... querying the miRNA Database miRANDA [85] and RNAhybrid [86] through a miRNA gateway miRNAMap 2.0 http://mir namap.mbc.nctu.edu.tw[44]. Gene annotations were conducted using web-based too...

Ngày tải lên: 18/06/2014, 15:20

... research, and analyzed data; MB designed the study, analyzed the data and wrote the paper; NZ preformed research and analyzed the data; SA preformed research and analyzed the data; EW designed the ... minutes and hold at 4°C. Sequencing reactions were run on an Applied Biosystem 3730xL DNA Analyzer and analyzed utilizing standard alignment software. RNA Preparation, RN...

Ngày tải lên: 18/06/2014, 15:20

... circularity, the perimeter, the area, and their ratio, as index of complexity. Statistical analysis Data were expressed as mean ± standard deviation (SD) or median and range. A comparison of the morphometric data ... 5 Cardiothoracic Department, Institute of Cardiovascular Medicine, Center of Clinical Physiology and Hypertension, Laboratory of Clinical Informatics a...

Ngày tải lên: 18/06/2014, 15:20

... explore the mechanisms of action of this promising new anti-diabetic agent are warranted. Abbreviations A. paniculata: Andrographis paniculata; Andro: androgra- pholide; AL-1: andrographolide-lipoic ... little insulin in the pan- creata of the glibenclamide-treated animals despite the fact that these animals had fairly large beta cell mass (Fig. 3), suggesting that the abil...

Ngày tải lên: 18/06/2014, 15:20