báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

... T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese population. ... polymorphisms in the IL2RA gene are associated with age at diagnosis in late-onset Finnish type 1 diabetes subjects. Immunogenetics 2010, 62:101-107. 36. Kawasaki E, Awata T, Ikegami H...

Ngày tải lên: 18/06/2014, 16:20

... TB Program Collaboration of Programs National HIV Program National HIV Program A Common TB and HIV Paradigm An Alternative TB and HIV Paradigm TB Services HIV Services C&T Antiretrovirals Ol Rx and Px Adherence ... supply of antiretroviral therapy. Finally, national TB and HIV programs in many countries may have limited authority to implement col- laborative models of care, either...

Ngày tải lên: 20/06/2014, 08:20

... size of cavities enables a high number of cav- ities on each chip and facilitates the performance of many independent assays on one plate. The funnel- shaped cavities avoid the appearance of meniscuses, ... in each cultivation segment guarantee a statistical analysis of the generated data. The MCC represents an array of miniaturized cell culture chambers for perman...

Ngày tải lên: 21/06/2014, 00:20

... 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The PCR product was ... respectively, as a direct electron acceptor. The animal and plant l-gul- onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate. Only scarce data are...

Ngày tải lên: 07/03/2014, 12:20

... application of the analytical results established. We believe that the established analytical results and the example together guarantee the reliability of numerical computation of those p-Laplacian and ... Dordrecht, The Netherlands, 2003. 5 V. Lakshmikantham, S. Sivasundaram, and B. Kaymakcalan, Dynamic Systems on Measure Chains, vol. 370 of Mathematics and Its Applicati...

Ngày tải lên: 21/06/2014, 11:20

... state of the art for voice rehabilitation [14]. After removal of the larynx, the breathing ability is maintained by a hole in the neck. A one-way shunt valve is placed between the trachea and the ... words) for the validation set (the training and validation corpora were the same as in [16]). This ASR system is integrated into the “Program for the Evaluati...

Ngày tải lên: 21/06/2014, 20:20

... iron nanoparticles act as nucleation and aggregation sites for carbon and the impending formation of diamond-type bonds. The forma- tion of a dense, mixed C phase around the Fe nanoparticles leading ... is limited, there occurs densification of trigonally and tetra- hedrally bonded carbon around the iron nanoparticle and the impending formation of diamond bonds. From the...

Ngày tải lên: 21/06/2014, 22:20

... simplified quasistatic testing approach allows to compare changes in the primary mechanical stability of the spinal segment after nucleotomy and after the implantation as well as to assess the initial maximal ... analysis of the data. HG gave substantial input to realize the biomechanical test set-up and advised in analyzing the data. ME advised about the use...

Ngày tải lên: 20/06/2014, 04:20