o cáo hóa học:" Glycyrrhizin as antiviral agent against Hepatitis C Virus" ppt

... Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research ... concentrations of 1-9%. Glycyrrhizin is a glyco- sylated saponin, containing one molecule of glycyrretinic acid, with structural similarities to hydrocortisone, and two molecules of glucur...

Ngày tải lên: 20/06/2014, 04:20

... GAPDH Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of denaturation at 92 C for 45s, ... the manufacturer’sprotocol.TotalRNAwasextractedby using Trizol reagent (Invitrogen life technologies, Carls- bad, CA) according to the manufacturer’sprotocol.To analyze the effect of GL agai...

Ngày tải lên: 18/06/2014, 22:20

... sequences of HCV-1g with respect to our sequence. Conclusion: In light of this, we propose changing the current status of its subtype-specific designation from provisional to confirmed. Background Hepatitis ... for the polyprotein (Fig. 1) was included in phylogenetic reconstructions along with 29 homologous complete genome sequences representative of the main HCV genotypes and subtypes (se...

Ngày tải lên: 20/06/2014, 01:20

... AGCTTAACTACAAGGACGACGACGATAAG- TAACTCGAG and TCGACTCGAGTTACTTATCGTCGTCGTCCTTGTAGTC- Virology Journal 2006, 3:38 http://www.virologyj.com/content/3/1/38 Page 5 of 9 (page number not for citation purposes) specific ... amplification were EcoRI-ORF1-5', TACGGAATTC ATGGAGGCCCAT- CAGTTTATCAAG and Hind III-ORF1-3', CCAAAGCTT T- GATTTCACCCGACACAAGATTGA, containing the underlined restrictio...

Ngày tải lên: 20/06/2014, 01:20

... efficiency correlates to the low RE observed for our MART-1 specific clone as expected, the high cyto- toxicity observed may be a reflection of co-stimulation of other cytokine production such as IFN-g ... 10 -6 M and decreasing by log steps to 10 -14 M. For each CTL clone, percent cytotoxicity was plotted against peptide concentration and the negative log of the concentration. The pept...

Ngày tải lên: 20/06/2014, 04:20

... further incubated at 25 C for 2 h. The amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against heparin con- centration. (B) An RdRp assay ... corresponds to two successive copies of the template [17]. Products of higher molecular weight in very low amounts were also visible. They may corres- pond to three (or more) successive cop...

Ngày tải lên: 20/02/2014, 01:20

... performed according to manufacturer's specifications. Clonal Frequency Analysis (CFA) For each cloned HVR1 PCR product, 20 colonies were picked directly into tubes for re-amplification of ... involves hybridization of a radioactive probe generated from a QS variant to either heterogeneous PCR reaction products derived by direct PCR amplification from clinical speci- mens, or to homogeneo...

Ngày tải lên: 19/06/2014, 08:20

... gataaatccatttctttctgttcc 60 C ERCC1 tcagtcaacaaaacggacagtcag tccttgggttctttcccagagc 60 C GSTP1 aacatgaggcgggcaag gttgtagtcagcgaaggag 60 C XPD aagcaggagggcgagaag cctcatagaatcggcagtgg 59 C HPRT agactttgctttccttggtcagg ... used for Real-Time PCR Gene name 5’ to 3’ forward primer 5’ to 3’ reverse primer Annealing temperature MGMT tcttcaccatcccgttttcc attgcctctcattgctcctc 60 C BRCA1 gctcgctga...

Ngày tải lên: 20/06/2014, 04:20

... subtract- ing the score at 1 year from the baseline score as a measure o f clinical disease progression. The correlation of CSF chitotriosidase activity to t he baseline func- tional score is provided in ... 3C) . The plasma chito- triosidase activity failed to correlate with either the Loes score one year post transplant or the change in Loes score (Figure 4B and 4C) . Correlations of Ch...

Ngày tải lên: 19/06/2014, 22:20