báo cáo hóa học:" The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" docx

Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc

Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc

... digits, and a bluetooth interface to allow real-time streaming of data to a PC for data logging. It has scored highly in terms of p atient satisfaction [ 23] and is an open-loop hand, making it an ... the black blobs. This analysis indicates that approximately 12 distinguishable stimuli can be perceived along the forearm. Saunders and Vijayakumar Journal of NeuroEngine...

Ngày tải lên: 19/06/2014, 08:20

12 504 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCC...

Ngày tải lên: 21/02/2014, 01:21

10 673 0
báo cáo hóa học: "Three-dimensional kinematic motion analysis of a daily activity drinking from a glass: a pilot study" pot

báo cáo hóa học: "Three-dimensional kinematic motion analysis of a daily activity drinking from a glass: a pilot study" pot

... grasping the glass with all fingers (no fingers at the bottom), lifting the glass from the table and taking a drink (one swallow), placing the glass back on the table inside the marked area and ... three-dimensional kinematic analysis of the drinking task. Our approach to investigate and analyze a goal-oriented daily activity has a great clinical potential. C...

Ngày tải lên: 19/06/2014, 10:20

11 294 0
Báo cáo hóa học: " The emerging role of insulin-like growth factor 1 receptor (IGF1r) in gastrointestinal stromal tumors (GISTs)" pdf

Báo cáo hóa học: " The emerging role of insulin-like growth factor 1 receptor (IGF1r) in gastrointestinal stromal tumors (GISTs)" pdf

... Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G, Matsuzawa Y, Kanakura Y, Shinomura Y, Kitamura Y: Gain of function mutations of c -kit in human gastrointestinal stromal tumors. Science 1998, ... University of Bologna, Italy. Authors’ contributions MAP and GB: concept and design. MAP, AA and MN: writing. AA and MN: literature analysis. All authors gave final a...

Ngày tải lên: 18/06/2014, 16:20

6 494 0
Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

... 9:75 http://www.translational-medicine.com/content/9/1/75 Page 3 of 8 REVIEW Open Access The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting Alessandra Maleddu 1* , ... 10555]. doi:10.1186/1479-5876-9-75 Cite this article as: Maleddu et al.: The role of mutational analysis of KIT and PDGF...

Ngày tải lên: 18/06/2014, 19:20

8 517 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢. ... details about the role of different resi- dues of the aglycone-binding site in the stabilization of ES à and the interdependence between the...

Ngày tải lên: 18/02/2014, 17:20

12 732 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... Renata Piccoli, for critical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, Antonella Antignani and Sonia Di Gaetano for preparing some of the RNase variants ... through rotation of the RNase around its major axis (rotation angle ‘r’) and variation of the inclination (inclination angle ‘i’) with respect to the plane of the...

Ngày tải lên: 19/02/2014, 06:20

11 644 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

... osmoregulation and sporulation. Isola- tion and characterization of yeast mutants blocked at various sta- ges of transport pathways are an invaluable method for unravelling the molecular details of vacuolar ... syndrome and adipocytokines Y. Matzuzawa Department of Internal Medicine and Molecular Science, Graduate School of Medicine Osaka University, Osaka, Japan Visceral...

Ngày tải lên: 19/02/2014, 07:20

7 749 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... (a) In the absence of one or more integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and m ost likely already associated in ... subunit of complex I (NDUFB6) served as a nother identification of the complex at the position o f the histochemical stain in the left panel. Antisera against...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... This indicates that N-glycans, in particular their terminal trimming, are important for the GABA-uptake activity of GAT1. They play a regulatory role in the GABA translocation by affecting the affinity ... used for the immunostaining. The protein bands obtained in western blotting were analyzed by phosphoimager scanning. The total protein of the cell surface and i...

Ngày tải lên: 19/02/2014, 17:20

14 655 0
w