báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 3 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... RESEARC H Open Access Insertion of the human sodium iodide symporter to faci...

Ngày tải lên: 20/06/2014, 03:20

14 393 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate d...

Ngày tải lên: 18/06/2014, 19:20

14 490 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

... reproducible, and was capable of measuring responses to a large panel of antigens in an individual regardless of genetic background. One advantage of the IFN-γ ELISPOT assay is that it does not require a ... potential targets for thera- peutic immunization. The basic premise is that any thera- peutic intervention that can alter the bias of the immune response tow...

Ngày tải lên: 20/06/2014, 01:20

15 329 0
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

... arithmetic: ‘one more unit means the same amount extra, no matter how much we already have’ [20]. So, an increase of one point for an ATAQ- IPF domain or total score means the same thing whether a respondent ... no association between FVC %, DLCO%, or 6MWD and ATAQ-IPF domain and total scores. We also used multivariable linear regression to examine the relationship between th...

Ngày tải lên: 20/06/2014, 16:20

9 719 0
Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

... Sdc4: forward, 5¢-GCGGCTCGGATGACTTTG-3¢; reverse, 5¢- AAGGGCTCAATCACTTCAGG-3¢. Cib3: forward, 5¢- ATGACTTCAACAATGACAACTAC-3¢; reverse, 5¢-ATC CAGCACCTTCTCACAG-3¢. Cyp 4a1 0 ⁄ 31: forward, 5¢-GC CTCTGTGCTCGGTCTG-3¢; ... 5¢-AGCCTTGAGTA GCCATTGCC-3¢. Cyp2c39: forward 5¢-TGCTCTCCTAC TCCTGATGAAG-3¢; reverse, 5¢-GGGCATGTGGTTCCT GTCC-3¢. Cdc20: forward, 5¢-GCAACAGGAGGAGGA ACCAG-3¢; reverse, 5¢-CATCC...

Ngày tải lên: 23/03/2014, 06:20

14 299 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

... elucidation of the pathways responsible for the decrease in pulmonary CTL function. As the mucosal sur- faces of the respiratory tract are a common site of entry and replication for various pathogens, ... protection against an exagger- ated and therefore harmful response. Possible mecha- nisms for this tissue- specific impairment could be a lack of factors necessary to...

Ngày tải lên: 20/06/2014, 01:20

8 381 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... increase the sig- nal to noise ratio. All of the spectra were corrected for the Raman signal and background by subtracting the spectrum of the buffer. ATPase activity Rad51 (5 lm) or a Rad51 mutant ... 2F) of the purified Rad51-F27 9A were all similar to those of HsRad51, indicating that the muta- tion did not affect the global structure, the polymer format...

Ngày tải lên: 19/02/2014, 06:20

12 662 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) ... underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢. The two amplified fragments were used as...

Ngày tải lên: 07/03/2014, 21:20

9 422 0
Từ khóa:
w