Báo cáo hóa học: " Iota-Carrageenan is a potent inhibitor of rhinovirus infection" docx
Báo cáo sinh học: " Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" pptx
... WJ, Farzan M, Marasco WA: Potent neutralization of severe acute respira- tory syndrome (SARS) coronavirus by a human mAb to S1 protein that blocks receptor association. Proc Natl Acad Sci USA 2004, ... EB participated in the plan- ning of the experiments, review and interpretation of data and critical review of the manuscript. All authors read and approved the content of the man...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... acquisition of data. NM helped to draft the manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ parti...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols described in this study were approved by ... 110, 151–164. 26 Tomari S, Nagahama H, Shu Y, Hoshi S, Nakayama K, Nakayama KI & Nagata M (2002) Glomerular dif- ferentiation in p27 and p57 double-mutant metanephroi. Anat Embryol 206, 3...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... potent partner of hsc70 in mammalian cells Petros Bozidis, Ioannis Lazaridis, Gerassimos N. Pagoulatos and Charalampos E. Angelidis Laboratory of General Biology, Medical School, University of Ioannina, ... corresponding cDNAwasamplifiedbyPCRusingprimerI(5¢-GCA GTAGAGGATCCTGAAAGAAA-3¢) and primer II (5¢-GTTATTCAGTCGACCATTAAGAGG-3¢) to gener- ate the convenient BamHI (at 5¢ end) and Sal...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... adhesion and activation. Three such molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isola- ted from Haementeria of cinalis) and calin and sara- tin (approximately 65 kDa and 12 kDa ... alimentary habit of hemato- phagy. The presence of anticoagulants in the salivary glands of the leech, Hirudo medicinalis, was originally discovered by Haycraft in 1884 and led to the...
Ngày tải lên: 30/03/2014, 09:20
báo cáo hóa học:" PAR1 is selectively over expressed in high grade breast cancer patients: a cohort study" docx
... 0.0001, data not shown). Also it was of interest to analyse the distribution of metastases by organ and the order of appearance on a Kaplan-Meier survival estimates of breast cancer patients overexpressing ... outcome of metastatic breast cancer patients, but also known as downstream mediators of PAR1 activation [17,18]. We used a 1:2000 dilution of a mouse monoclonal anti...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx
... two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter-1 (GLT-1/EAAT2), the glutamate transaminase, glutamine synthetase (GS) and the calcium regulatory protein ... analysis of tenascin and analysis of GFAP by Western and ELISA. JKK and SWL designed and supervised the studies. All authors have read and approved of the final manuscript. Acknowledgem...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?" docx
... TGAGATACGTGTTGACGTCC TTCCTTATTTCCTTTCACACCC S67722 TNF-α CTCTTCTCATTCCTGCTCGT GAGAAGATGATCTGAGTGTGAG AJ002278 IL-1β CATAAGCCAACAAGTGGTATTCTC TGTTTGGGATCCACACTCTC NM_031512 IL-6 CAGGGAGATCTTGGAAATGAG ... lingual (LA) and the maxillary artery (MA). Distal to the ligature the LA and MA were coagulated and cut. A small arteriot- omy was made in the ECA stump and a filament with a rounded ti...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard. Assessment of motor ... Copeland NG, Jen- kins NA, Sisodia SS, Cleveland DW, Price DL. An adverse property of a familial ALS-linked SOD1 mutation causes motor neuron disease characterized by vacuolar...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d 1 synthesis. Experimental procedures DNA manipulations DNA ... 25 2.2 2 1.8 1.4 1.2 1.6 1 0.8 0.6 0.4 0.2 0 A 600 A 600 A 600 Time (h) Fig. 5. His41 is essential for Paracoc- cus pantotrophus NirF, but Asp129 is dis- pensable. Growth...
Ngày tải lên: 15/02/2014, 01:20