Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850 , respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823 ; AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGG...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx
... command LAA update request command A B C D EFH I J Figure 4: An example of the address assignment based on LAA. a node A initiates the creation of a new ZigBee network by assigning itself as a ... (d)Interval,Cskip(d) 021 15 21 30 ZigBee standard, ZigBee Pro by now, claimed that the newest standard could handle thousands of sensors. However, we believe that our proposal, alt...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: " Research Article An Alternative Method to Compute the Bit Error Probability of Modulation Schemes Subject to Nakagami-m Fading" pdf
... Nakagami-m fading channel is seen as an additive noise channel whose noise is modeled as the ratio between a Gaussian random variable and a Nakagami- m random variable. Exact and closed-form expressions ... for an AWGN channel, a closed-form expression for the BEP of M-QAM for an AWGN channel has been derived only in 2002 [4]. Regarding the performance evaluation of...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Holoprosencephaly in an Egyptian baby with ectrodactyly-ectodermal dysplasia-cleft syndrome: a case report" doc
... expression and can occur as a separate entity, the combination of all three anomalies appears to be a rare occurrence [6]. HPE is a complex brain malformation affecting both the forebrain and the face. ... holoprosencephaly. Authors’ contributions KA and HS diagnosed, investigated, followed-up and managed the patient and drafted the manuscript. Both authors read and approv...
Ngày tải lên: 21/06/2014, 19:20
báo cáo hóa học:" Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature" pdf
... approximately 20% of all ovarian tumors. Of these, approximately 15% con- tain normal thyroid tissue. Struma ovarii is a monoder- mal variant of ovarian teratoma, which predominantly contains thyroid ... 52(1):94-96. doi:10.1186/1757-2215-3-18 Cite this article as: Jiang et al.: Struma ovarii associated with pseudo- Meigs’ syndrome and elevated serum CA 125: a case report and re...
Ngày tải lên: 20/06/2014, 07:20
báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf
... 2006 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 Focus Botswana Cote d'Ivoire Ethiopia Kenya Mozambique Namibia Nigeria Rwanda South Africa Uganda United Republic of Tanzania Zambia Duber et al. Journal of the International AIDS Society ... (IQRs). † PEPFAR focus countries are Botswana, Cote d'Ivoire, Ethiopia, Kenya, Mozambique, Namibia, Nigeria, Rwanda, South Africa, Uganda, United Republ...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Association between treated/untreated traumatic dental injuries and impact on quality of life of Brazilian schoolchildren" pot
... DG, IP and MV conceptualized the rationale and designed the study. CB, SP, CT, AO, DG and MV performed the data collection, statistical analysis and interpretation of the data. CB, SP, CT and DG ... research team was made up of three dentists (CBB, DG and CST), who had participated in a training and calibration exercise for each clinical condition. The Andreasen classifi...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo hóa học: " Research Article An Energy-Efficient MAC Protocol in Wireless Sensor Networks: A Game Theoretic Approach" pptx
... wait- ing time in backoff procedure. In “Incomplete Game”, access delay performance is far better than “NM”, and comparable with “IBM”, as it can easily adapt the variable game state and choose the ... proceding of International Symposium on Fusion Tech (ISFT), January 13–15, 2009. [14] S. Mehta and K. S. Kwak, “Performance analysis of binary exponential backoff andimprovedbackoff for...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article Remarks on Cone Metric Spaces and Fixed Point Theorems of Contractive Mappings" pptx
... obtain similar results as Theorem 4 for example in 1. References 1 L G. Huang and X. Zhang, “Cone metric spaces and fixed point theorems of contractive mappings,” Journal of Mathematical Analysis ... Combinatorics and Ordered Sets (Arcata, Calif., 1985), vol. 57 of Contemporary Mathematics, pp. 175–226, American Mathematical Society, Providence, RI, USA, 1986. 11 M. A. Kha...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article On the Connection between Kronecker and Hadamard Convolution Products of Matrices and Some Applications" pptx
... 763–784, 2007. 8 A. Kilic¸man and Z. Al Zhour, “The general common exact solutions of coupled linear matrix and matrix differential equations,” Journal of Analysis and Computation, vol. 1, no. ... pages doi:10.1155/2009/736243 Research Article On the Connection between Kronecker and Hadamard Convolution Products of Matrices and Some Applications Adem Kılıc¸man 1 and Zeyad...
Ngày tải lên: 22/06/2014, 02:20