báo cáo hóa học:" Development of an in vitro three dimensional loading-measurement system for long bone fixation under multiple loading conditions: a technical description" potx

Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx

Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx

... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCAT- GGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACA- GAGTC-3'), ... protease, and an ubiq- uitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has b...

Ngày tải lên: 19/06/2014, 08:20

8 481 0
báo cáo hóa học: "Development of an automated speech recognition interface for personal emergency response systems" ppt

báo cáo hóa học: "Development of an automated speech recognition interface for personal emergency response systems" ppt

... VY participated in the background research, drafting of the article and is performing the next phase of the research. JB assisted with the system design and testing, data analysis, and drafting ... ON, Canada and 2 Intelligent Assistive Technology and Systems Lab, Department of Occupational Science and Occupational Therapy, University of Toronto, Toronto, ON, Canada Email: Melin...

Ngày tải lên: 19/06/2014, 08:20

11 608 0
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf

Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf

... than eight years of age. In another Australian study the Royal Alexandra Hos- pital for Children (RAHC) Measure of Function-Clinical Rating Scale was used to evaluate QoL: 60% of survivors had ... normative data. High scores represent a better HRQoL Table 1: Patient characteristics of participants and non- participants Participants n = 81 Non-participants n = 61 Median (range)...

Ngày tải lên: 18/06/2014, 22:20

9 440 0
Báo cáo hóa học: "Validation of an individualised quality of life measure in older day hospital patients" docx

Báo cáo hóa học: "Validation of an individualised quality of life measure in older day hospital patients" docx

... The Patient Generated Index was administered at baseline, one week later, and at the end of Day Hospital attendance. Functional Limitations Profile, Hospital Anxiety and Depression Score, Barthel ... Barthel index and global subjective impressions of change were also collected and compared with baseline scores and change in Patient Generated Index scores. Reliability was assessed using...

Ngày tải lên: 18/06/2014, 22:20

7 477 0
Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

... right hand avatar allowed flexible use of the postural segments for balance maintenance and arm transport. All participants practiced ten 90-s gaming trials during a single session, followed by a ... as dressing, doing laundry, and c ooking whe n performed in a standing position. For these tasks, gaining control of the arm-postural interaction supports successful and safe perf...

Ngày tải lên: 19/06/2014, 08:20

11 793 0
Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot

Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot

... to the angle between femur and shank - right and left ankle dorsiflexion: the angle between shank and foot Statistical analysis Continuous data were summarised in terms of means and standard deviation ... Physical Activity) and in Group NSPA (Non-Specific Physical Activity) at baseline and 3 months. Group APA Group NSPA baseline after 3 months p baseline After 3 months p mean SD mean S...

Ngày tải lên: 19/06/2014, 08:20

11 557 0
báo cáo hóa học: " Involvement of β-chemokines in the development of inflammatory demyelination" ppt

báo cáo hóa học: " Involvement of β-chemokines in the development of inflammatory demyelination" ppt

... a dose dependent manner, and to reduce clinical EAE in rat [36- 38]. In sum, CCL and CCR data from rodent EAE models using inbred, transgenic and knockout strains along with data from chemokine-specific ... phospholipase C and induce Ca 2+ influx and protein kinase C activation. The involvement of MAP kinases as well as JAK/STAT signaling also has been shown [6]. As of today, 10 CC...

Ngày tải lên: 19/06/2014, 22:20

14 421 0
Báo cáo khoa học: Development of an HSV-tk transgenic mouse model for study of liver damage pptx

Báo cáo khoa học: Development of an HSV-tk transgenic mouse model for study of liver damage pptx

... mice (data not shown). Biochemical analysis of the blood Twenty-one days after the injection of GCV, the values of alanine aminotransferase (ALT), aspartate amino- transferase (AST) and total bilirubin ... (SAS Software). A P-value < 0.05 was considered significant. PCR analysis for the integration of the transgene The transgene in the founder animals and their progeny was ide...

Ngày tải lên: 30/03/2014, 16:20

9 475 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

... therapeutic potential and is a very promising candidate for ovarian cancer ther- apy in humans. Materials and methods Cell culture The human ovarian carcinoma cell lines (ES-2, SKOV-3, TOV-112D and ... interpretation of data, and critically revised the manuscript. PO participated in design, coordination, and data interpretation and drafted the manuscript. All authors read and approv...

Ngày tải lên: 18/06/2014, 15:20

11 559 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

... software. Another 4 healthy mice were used as control. The total tumor area of each bladder was determined and the mean of the total areas was calculated for each group. The Mean and SD of bladder ... signal transduction and/or promo- ter activation was reported as a major mechanism for the IGF2 overexpression in a variety of tumors including bladder carcinoma, hepatocellula...

Ngày tải lên: 18/06/2014, 16:20

18 746 0
w