the taxonomic study of foliicolous lichenized fungi in chu yang sin national park of vietnam

... catch them, to provide supplementary food for their families and neighbours. The 2 The illegal wildlife and timber trade network around Chu Yang Sin National Park, Dak Lak Province, Vietnam ... Trai and Mahood, S. P. (2008). The illegal wildlife and timber trade network around Chu Yang Sin National Park, Dak Lak Province,...

Ngày tải lên: 20/12/2013, 23:15

... psychological training as an asset. An additional 36% of these articles described the unique skills of psychologists as potentially favorable or unfavorable, whereas the remaining 18% of articles ... acknowledging and using the organiza- tional environment in which the manager operates, selecting various aspects of the individual's behav- ior for tutorials, a...

Ngày tải lên: 21/02/2014, 16:20

... dependence of the steady-state kinetic parameters of MAO A- catalysed oxidation of benzyl- amine at 20 °C. Fig. S2. pH dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine ... was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ a...

Ngày tải lên: 07/03/2014, 06:20

... eukaryotes and archaea, and there is also variation within bacteria. We also focused on the lysine-degradation pathway because the substrates and intermediates of the pathway are structurally ... reconstruction of the lysine- degradation pathway of P. aeruginosa, because this pathway contains many missing enzymes and our understanding of the detailed enzymatic...

Ngày tải lên: 07/03/2014, 09:20

... m. However,due to the action of old river systems, in someplacesthereisnotrace of the finegrain sediments, but there remain only the coarse grainedsediments of river bed facies, whichare of high  storage and water bearing capacity.  These ... Science and Technology in Top Botto m Top Bottom VNUJournal of Science,EarthSciences23(2007)170‐176 170...

Ngày tải lên: 28/03/2014, 15:20

... purposes) Human Resources for Health Open Access Review Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature Maman Dogba* 1 and ... importance of human resources in the quality of emergency obstetric care and thus in the reduction of maternal deaths. Met...

Ngày tải lên: 18/06/2014, 17:20

... A thesis for Degree of Master of Science The taxonomic study of foliicolous lichenized fungi in Chu Yang Sin national park of Vietnam Thi Thuy Nguyen Department of Environmental ... The taxonomic study of foliicolous lichenized fungi in Chu Yang Sin national park of Vietnam Supervisor: Prof. Jae-Se...

Ngày tải lên: 19/06/2014, 11:24

... production and the choices of fresh lychee marketing channels of producers in Thanhha district, Haiduong province. Research methodologies are used in the study consisted of selection of the study ... lychee productivity and the choices of fresh lychee marketing channels of producers in Thanhha district, Haiduong province. Key words: Choices, fresh...

Ngày tải lên: 06/08/2014, 18:22

... could then be considered as a potential and optional candidate for maintaining the habitat diversity of SDT and CWD. An integrated forest management could then Snags in ancient forests of French Alps ... 135–142 © INRA, EDP Sciences, 2005 DOI: 10.1051/forest:2005005 Original article The management of snags: A comparison in managed and unmanaged ancie...

Ngày tải lên: 08/08/2014, 00:21

... M.G.A., Arbuscular mycorrhizal fungi as a deter- minant of plant diversity: in search of underlying mechanisms and general principles, in: Van der Heijden M.G.A., Sanders I. (Eds.), Mycorrhizal ... Effect of arbuscular mycorrhizal inocu- lation on micropropagated Tetraclinis articulata growth and survi- val, Agronomie 16 (1996) 633–637. [20] Morte M.A., Honrubia M.,...

Ngày tải lên: 08/08/2014, 00:22

... constant with any further increase of the cambial age of growth rings. Increase in the earlywood vessel lumen diameter in the outerwood was significant compared with that in ... greater the diameter of earlywood vessel lumen (fig 3, for example, for a dominant tree). For late- wood vessels, with increasing age of growth rings...

Ngày tải lên: 08/08/2014, 19:21

... glycolysis and the pentose phosphate pathway to glucose respiration in ectomycorrhizas and non-mycorrhizal roots of spruce (Picea abies L. Karsten) I. Bilger, V. Guillot, F. Martin F. Le ... In non-mycorrhizal explorato- ry roots, 38% of the carbohydrate oxida- tion was via the pentose phosphate pathway and 62% was via g...

Ngày tải lên: 09/08/2014, 04:20

... upon three chemokines, namely CCL5, CXCL10 and CCL3, which are potential novel therapeutic targets in arthritis. The aim of the study was to analyse the expression and production of these three chemokines ... expressed CCL5 protein (Figure 6). In addition, staining was demonstrated at the synovial lining and on many infiltrating inflammatory cells. Protei...

Ngày tải lên: 09/08/2014, 07:20

... the urinary bladder treated with external radiotherapy in a patient with a history of transitional cell carcinoma: a case report. Journal of Medical Case Reports 2010 4:70. Papandreou et al. Journal ... Primary osteosarcoma of the urinary bladder. Int Urol Nephrol 1997, 29:437-440. 7. Young RH, Rosenberg AE: Osteosarcoma of the urinary...

Ngày tải lên: 11/08/2014, 11:23

... some point in the study, whereas 43.7% of the male dogs were Cryptosporidium positive. For Giardia, 22.1% of the female and 19.7% of the male dogs were Giardia positive at some point in the study. Multiple ... [49]. Interestingly, 50.7% of the Giardia positive dogs had the highest level of intensity of infection (3+), whereas only 16.7% of th...

Ngày tải lên: 12/08/2014, 18:22