báo cáo hóa học: " A new measurement method for spine reposition sense" ppt

... Central Page 1 of 6 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research A new electromechanical trainer for sensorimotor rehabilitation ... cm. Treatment The patient sat comfortably on a chair with a backrest, with the device on a height-adjustable table in front of him. A therapist positioned the forearm on the arm sup-...

Ngày tải lên: 19/06/2014, 08:20

... first application of Kernel PCA to a true natural language processing task. We have shown that a KPCA-based model can significantly outperform state-of-the-art results from both na¨ıve Bayes as well ... NLP applications (e.g., Takamura and Matsumoto (2001), Isozaki and Kazawa (2002), Mayfield et al. (2003)) including the word sense disambiguation task (e.g., Cabezas et al. (2001)). Given tha...

Ngày tải lên: 20/02/2014, 16:20

... say, ten candidate translations to help the transla- tor. We obtained the evaluations of three human judges (El-E3). Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and ... sentence alignment. Existing lexicon compilation methods (Kupiec 1993; Smadja & McKeown 1994; Kumano & Hirakawa 1994; Dagan et al. 1993; Wu & Xia 1994) all attempt to extract pa...

Ngày tải lên: 20/02/2014, 22:20

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGC...

Ngày tải lên: 07/03/2014, 21:20

... above, a sentence-initial cap- italized word which is adjacent to other capital- ized words is not necessarily a part of a proper name, and also many common nouns and plural nouns can be used as ... argue that a part-of-speech tagger can capture that in the first case the word "All" modified a singular proper noun ("Bank") and hence is not grammatical as...

Ngày tải lên: 17/03/2014, 07:20

... done by the native-speaker of English. From the com- parison, recall and precision were calculated. Then, the feedback-augmented method was evaluated on the same target essays. Each target essay in ... Japan rnagata@hyogo-u.ac.jp Atsuo Kawai Mie University 5148507, Japan kawai@ai.info.mie-u.ac.jp Koichiro Morihiro Hyogo University of Teacher Education 6731494, Japan mori@hyogo-u.ac.jp Naoki...

Ngày tải lên: 23/03/2014, 18:20

... Systems Research Laboratories NEC Corporation 1-1, Miyazaki 4-chome, Miyamae-ku, Kawasaki-city, Kanagawa 213, Japan ABSTRACT The following proposal is for a Japanese sentence analysis method ... Examples of Japanese Word. 166 A SENTENCE ANALYSIS METHOD FOR A JAPANESE BOOK READING MACHINE FOR THE BLIND Yutaka Ohyama, Toshikazu Fukushima, Tomoki Shutoh and Masamichi Sh...

Ngày tải lên: 31/03/2014, 17:20

... methylamine dehydrogenase (MADH) and aromatic amine dehydroge- nase (AADH), and also the flavoenzymes trimethylamine dehydrogenase (TMADH) and heterotetrameric sarcosine Fig. 1. Schematic representation ... B.G., Robb, M .A. , Cheeseman, J.R .A. K.T., Petersson, G .A. , Montgomery, J .A. , Raghavachari, K. et al. (1995) Gaussian94. Gaussian Inc, Pittsburgh PA. 34. Pearlman, D .A. , Case, D .A....

Ngày tải lên: 31/03/2014, 23:20

... are archaeal PolI, archaeal DNA polymerase II (PolII), bacterial DNA polymerase III α sub- unit (DnaE) and bacteriophage DNA polymerase I. Among these, archaeal PolI belongs to the family B DNA polymerase. ... polymerases from the Archaea, Bacteria and Eukarya domainsFigure 3 Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains. The Mimivirus PolB seq...

Ngày tải lên: 18/06/2014, 22:20

... Similar to the trunk tests, the partici- pants were asked to perform a normal forward reach, a normal lateral outward reach, and two abnormal forward reaches with shoulder abduction and/or internal ... herve.lacheray@quanser.com; Don Gardner - don.gardner@quanser.com; Jacob Apkarian - jacob.apkarian@quanser.com; Alex Mihailidis* - alex.mihailidis@utoronto.ca * Corresponding author Abstr...

Ngày tải lên: 19/06/2014, 08:20