Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

... Access Research Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation -RNA replication system by viral protein 3CD pro David Franco 1 , Harsh B Pathak 2 , Craig E Cameron 2 , ... include protein 3AB, the precursor of 3A, which is a small membrane binding and RNA binding protein, the terminal pro...

Ngày tải lên: 19/06/2014, 08:20

19 489 0
Báo cáo sinh học: " Etiopathology of chronic tubular, glomerular and renovascular nephropathies: Clinical implications" docx

Báo cáo sinh học: " Etiopathology of chronic tubular, glomerular and renovascular nephropathies: Clinical implications" docx

... Hospital Universitario de Salamanca, Salamanca, Spain. 3 Unidad de Fisiopatolog a Renal y Cardiovascular. Departamento de Fisiolog a y Farmacolog a, Universidad de Salamanca, Spain. 4 National Institutes ... U.S. Renal Data System, USRDS 2005 Annual Data Report: Atlas of End- Stage Renal Disease in the United States, National Institutes of Health, National Institute of Diabetes an...

Ngày tải lên: 18/06/2014, 19:20

26 351 0
Báo cáo sinh học: "Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" potx

Báo cáo sinh học: "Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" potx

... Journal of Translational Medicine 2011, 9:28 http://www.translational-medicine.com/content/9/1/28 Page 3 of 7 RESEARCH Open Access Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and ... that has a functional role in allergic disease and resistance to intestinal nematodes [29], but no data is yet available on its role in heart disease. IFN-g is an important pro-...

Ngày tải lên: 18/06/2014, 19:20

7 424 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

... determination of JC viral loadFigure 1 A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load. JCV (Mad1), propagated in Dr. Walker's laboratory ... reproducible over a large dynamic range, and real-time PCR was more reliable than the HA assay for in vitro calculation of initial virus inoculum and replicate...

Ngày tải lên: 19/06/2014, 08:20

5 358 0
Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

... evaluation,” in Proc. 4th International ACM Workshop on Modeling, Analysis and Simulation of Wireless and Mobile Systems, Rome, Italy, July 2001. Matteo Gandetto was born in Alessandria, Italy, in ... Bluetooth can interfere with WLAN and vice versa. The use of time and frequency analysis allows one to identify the presence of the two standards at a particular time insta...

Ngày tải lên: 23/06/2014, 01:20

13 456 0
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx

Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx

... pcDNA3.1(+) vector and the myc-tag was fused to the C-terminus of RSV-F by ligating annealed primers (Sigma) mycTAAs: 5'- tcgaggaacaaaaactcatctcagaagaggatctgtaat and mycTAAa: 5'-ctagattacagatcctcttctgagatgagtttttgttcc ... cDNA was amplified by PCR (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattattt...

Ngày tải lên: 18/06/2014, 18:20

10 409 1
Báo cáo sinh học: " Phosphorylation of HIV Tat by PKR increases interaction with TAR RNA and enhances transcription" potx

Báo cáo sinh học: " Phosphorylation of HIV Tat by PKR increases interaction with TAR RNA and enhances transcription" potx

... consequences of this phosphorylation on Tat function and have shown that it results in increased and stronger binding of Tat to TAR RNA. Tat protein is an essential regulatory protein during viral transcription ... may result in an increased net positive charge by either exposing basic amino acids or masking negative amino acids, and this increases the attraction to neg...

Ngày tải lên: 18/06/2014, 22:20

13 410 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse ... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGA...

Ngày tải lên: 19/02/2014, 16:20

10 488 0
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

... neokyotorphin may target one of the ele- ments of the PKA-signaling system. PKA may activate the Ca 2+ L-type channel, resulting in an increase in the Ca 2+ in ux, elevation of the intracellular Ca 2+ level ... presence of BAPTA-AM. The effect of neokyotorphin was sup- pressed at both concentrations of BAPTA-AM. These results indicate that Ca 2+ in ux via the L-type channel...

Ngày tải lên: 07/03/2014, 11:20

11 726 0
w