Báo cáo sinh học: " Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis" docx

... specifications. Clonal Frequency Analysis (CFA) For each cloned HVR1 PCR product, 20 colonies were picked directly into tubes for re -amplification of the sec- ond round PCR product. Thus, for ... by CFA. AVG represents average. BioMed Central Page 1 of 11 (page number not for citation purposes) Virology Journal Open Access Research Comparison of amplification enzymes fo...

Ngày tải lên: 19/06/2014, 08:20

... Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of denaturation at 92 C for 45s, ... concentration Following formula was used to calculate the c oncentra- tion HCV RNA of each sample. Cy3STD/Res Fam. STD / Res × coefficient IC = IU HCV/m L IC = internal control, which is s...

Ngày tải lên: 18/06/2014, 22:20

... reflective of a widespread lack of information technology and telecommunications across the African region: a 2004 study conducted by the WHO Regional Office for Africa showed that 22% of health workforce ... long- standing civil conflict in those areas. Profile of the health workforce Globally, the health workforce is characterized by a diver- sity of occupations and skills. Howe...

Ngày tải lên: 18/06/2014, 17:20

... first denaturation step of 10 min at 95 C, followed by 40 cycles of 95 C for 10 sec and 60 C for 15 sec and the amplification fluorescence was read at 60 C at the end of the cycle. Real-time PCR amplification ... site(s) of initial infection, the mechanism(s) of JCV reactivation, cellular susceptibility, trafficking across the blood-brain-barrier and lytic infection of...

Ngày tải lên: 19/06/2014, 08:20

... echocardiography for the detection of coronary artery disease in women. Am J Cardiol. 2007;99:714-717. 37. Marwick TH, Shaw L, Case C, et al. Clinical and economic impact of exercise electrocardiography ... report of the American Col- lege of Cardiology/American Heart Association Task Force on practice guidelines (Committee on the Management of Patients with Chronic Stable...

Ngày tải lên: 03/11/2012, 10:58

... the efficacy of potential therapeutics for MARVFigure 9 Use of the 'scid-adapted' MARV model to assess the efficacy of potential therapeutics for MARV. Scid mice were infected IP ... system of scid mice are NK cells, except for a few immature B or T cells due to 'leakiness' of the scid system, Adaptation of MARV to severe combined immunodeficiency (scid...

Ngày tải lên: 18/06/2014, 18:20

... induced downregulation of A3G in prostate cancer cells We used culture supernatant from chronically infected LNCaP cells with XMRV as the source of infectious XMRV. Virus infections were performed ... xenotropicMLV related virus in prostate cancer cases and cancer- freecontrols. Mol. Cell. Probes 2010,25:134–136. 6. Fischer N, Hellwinkel O, Schulz C, Chun FK, Huland H, Aepfelbache...

Ngày tải lên: 18/06/2014, 18:20

... perspectives are discussed. Introduction to chronic kidne y disease Definition and clinical course Chronickidneydisease(CKD)comprisesagroupof pathologies in which the renal excretory function is chronically ... diseases, renal and systemic infections (e.g. streptococcal infections, bacterial endocar- ditis, human immunodeficiency virus - HIV-, hepatitis B and C, etc.), polycystic kidney...

Ngày tải lên: 18/06/2014, 19:20

... (5'-ATCCCTCCAAATTCCGACAC-3') MSV MSVR (5'-TCCATGTACAAAGCTCCTCT-3') MSV C1 F (5'-GCAGATCTATGCCTCGTTTATTTAAAATATATGC-3') TYLCV C1 R (5'-GCGGTACCTTACGCCTTATTGGTTTCTTCTTGGC-3') TYLCV TMVF ... (5'-TGTTTATTAATTGCCAATACT-3') ACMV (AV1/CP) UniF (5'-KSGGGTCGACGTCATCAATGACGTTRTAC-3') CMGs DNA A UniR (5'-AARGAATTCATKGGGGCCCARARRGACTGGC-3...

Ngày tải lên: 19/06/2014, 08:20