Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... 6. Tanaka A, Abe T, Matsuura A. Prevention of postoperative intrapleural adhesion of the thoracotomy incision by a biore- sorbable membrane in the rat adhesion model. Ann Thorac Cardiovasc ... Research Paper Prevention of Pleural Adhesions Using a Membrane Containing Polyeth- ylene Glycol in Rats Volkan Karacam 1 , Ahmet Onen 2 , Aydin Sanli 2 , Duygu Gurel 3 , A...
Ngày tải lên: 25/10/2012, 11:00
Tài liệu Báo cáo khoa học: Prevention of thermal inactivation and aggregation of lysozyme by polyamines docx
... measuring the absorbance (A) at 600 nm. The rate constant of inactivation was determined by fitting the data to a linear extrapolation. CD spectra Far-ultraviolet CD spectra were measured using a ... Kentaro Shiraki 1 , Shinsuke Fujiwara 2 , Tadayuki Imanaka 3 and Masahiro Takagi 1 1 School of Materials Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan; 2...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... 5′-TGTCTCGTGTTACAGGCGGGGT-3', asymmetric primer 2 was 5′-GAGGCATAGCAGCAGGA GAAGAG-3', and fluorescent primer was 5′-TCGCTGGAAGTGTCTGCGGCGT-3'. Serum assays Fasting blood was collected ... recruited into this study. The levels of fasting blood glucose (FBG), fasting insulin (FINS), triglyceride (TG), cholesterol (CHOL), alanine amino- transferase (ALT), aspartate amin...
Ngày tải lên: 25/10/2012, 11:48
Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"
... the American Association for the Study of Liver Diseases as past Chairman of both the Training and Education and the Publications Committees. He is also a past councilor of the International ... Transplantation at Cedars-Sinai Medical Center. His basic and translational research interests involve the immunological and inflammatory mechanisms of pathogenesis in alloimmune and...
Ngày tải lên: 02/11/2012, 11:17
Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx
... response. Abbreviations ALT, alanine aminotrasferase; AST, aspartate aminotrasferase; CLP, cecal ligation and puncture; CYP, cytochrome P450; GdCl 3 , gadolinium chloride; GSH, glutathione; GSSG, glutathione ... using a digital camera (DC120; Eastman Kodak, New Haven, CT, USA) and densitometric scanning analysis software (1d main; Advanced American Biotechnology, Fullerton, CA, USA). Stat...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
... Horse- radish peroxidase-conjugated antibody against caspase-3 (#610325) was from BD Pharmigen, and antibody against b-actin (A5 441) was from Sigma. Statistical analysis All data are expressed as ... examined the main steps involved, following the uptake of satu- rated and unsaturated FFAs into the cells. After their internalization, FFAs are converted to fatty acyl-CoA, a reaction...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx
... GCCGCCACCATGCACCATCACCATCACCATCACCAT CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC p1(r) GGCCACTATCGATGCATCAGATG ClaI p2(f) CATCTGATGCATCGATAGTGGCC ClaI p2(r) GTGTTTGGGCCGAGTGGGAT BamHI b p3(f) GCCATTGATTCGTCCGACTA BamHI b p3(r) ... GGCACTAGTATGCAATCAGACATTGCG SpeI pK47 3A( mut) CCATCAGGAAGCGGC GCATCAACAATTG CGTCTTTG pE599Q(mut) CTTATTTTAGAT CAAGCAACCAGTGCC pH 631 A( mut) CTATATCAATTGCA GCGAGGCTTTCGA...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt
... 5¢-GTAGGCATGAGAACGGGA AG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGA AA-3¢ and for CERK-negative forward 5¢-CCGCAAG AGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGA CACGGAGAT-3¢, as a negative control ... MEBCYTO Apoptosis Kit was purchased from Medical and Biological Laboratories (Nagoya, Japan), and a Nuclear Extract Kit was from Active Motif (Carlsbad, CA, USA). The ChIP Assay Kit was also a...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus pptx
... domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). ... Authors Journal compilation ª 2011 FEBS 2397 Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus Takashi Yamasaki 1 , Yosuke Na...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Involvement of lysine 1047 in type I collagen-mediated activation of polymorphonuclear neutrophils doc
... antiplasmin variants as studied by surface plasmon resonance. Biochim Biophys Acta 1764, 1730–1734. 16 Wang H, Yu A, Wiman B & Pap S (2003) Identification of amino acids in antiplasmin involved ... specific amino acids in protein–protein interactions. For instance, selective carbamylation of the a- amino group of the tissue inhibitor of metalloproteinases-2 NH 2 -ter- minal...
Ngày tải lên: 07/03/2014, 06:20