Báo cáo sinh học: " Integral representations for solutions of some BVPs for the Lame'''''''' system in multiply connected domains" pot
Tài liệu Báo cáo khoa học: "Word representations: A simple and general method for semi-supervised learning" doc
... learningapproach that we use is that it is simpler and more general than that of Ando and Zhang (2005) and Suzuki and Isozaki (2008). Their methods dictate a particular choice of model and training ... the final NER F1 results. We compareto the state-of-the-art methods of Ando and Zhang(2005), Suzuki and Isozaki (2008), and for NER—Lin and Wu (2009). Tables 2 and 3 showthat accuracy can be ... improve generalization accuracy. Semi-supervised models such as Ando and Zhang(2005), Suzuki and Isozaki (2008), and Suzukiet al. (2009) achieve state-of-the-art accuracy.However, these approaches...
- 11
- 687
- 0
Báo cáo sinh học: " Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser Surgery" pot
... 2005,36:186-192.doi:10.1186/1479-5876-9-20Cite this article as: Stelzle et al.: Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser Surgery. Journal of Translational Medicine ... 1).Discussion For feedback controlled laser surgery, tissue differentia-tion is a crucial step. Especially in oral and maxillofacial Figure 2 Non-standardized diffuse reflectance spectra for different ... Autofluorescence and diffuse reflectance spectroscopy for oral oncology. Lasers Surg Med 2005, 36:356-364.30. Lin WC, Toms SA, Jansen ED, Mahadevan-Jansen A: Intraoperativeapplication of optical spectroscopy...
- 9
- 383
- 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... as follows: Periostin(forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-GATTTCCCGC ... 9:99http://www.translational-medicine.com/content/9/1/99Page 8 of 10hyperplasia; HE: hematoxylin and eosin; iTRAQ: isobarictags for relative and absolute quantification; PAP: pro-static acid phosphatase; PCa: prostate cancer; PIN: pro-static ... indicates that Periostin as an up-regulated protein in PCa may be a promising target of therapeutical intervention for PCa in future.Keywords: Periostin, Prostate cancer, RNAi, Proliferation,...
- 10
- 362
- 0
Báo cáo sinh học: " Integral representations for solutions of some BVPs for the Lame'''' system in multiply connected domains" pot
... 36:257–303.28However these are not the only integral representations that are of importance. Another one consists in looking for the solution of the Dirichlet problem in the form of a simple layer potential. ... derivatives of a double layer potential. This leads to the construction of a reducing operator, which will be useful in the study of the integral system of the first kind arising in the Dirichlet problem.Section ... β = 0 for any γ such that S∗γ = 0, S∗being the adjoint of S (for more detailssee, e.g., [9, 10]).We end this section by defining the spaces in which we look for the solutions of the BVPs...
- 30
- 359
- 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... AccessReview Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseasesHervé Le Calvez*1, Mang Yu2 and Fang Fang2Address: 1Abgent, Inc. 6310 Nancy Ridge Drive, ... antibody indicated for prevention and treatment of respiratory syncytialvirus (RSV) has heralded a new era for viral infection prevention and treatment. This emerging paradigm, herein designated ... the dominating approach to develop prophylaxis against viral infections through immunological prevention. However, vaccines are not always possible tomake, are ineffective for many viral infections, ...
- 6
- 568
- 0
Báo cáo hóa học: " Robotically facilitated virtual rehabilitation of arm transport integrated with finger movement in persons with hemiparesis" potx
... Piano trainer kinematic analyses. a. Daily averages during Virtual Piano training for finger fractionation defined as the differencebetween the angle of the MCP joint of the cued finger and of the ... training. Ourpast work has used virtual reality gaming simulat ions toexercise finger movements of a stationary hand, includ-ing functional individual finger mot ions and whole handopening/closing, ... decrease in the Jebsen Test of Hand Function.Conclusions: Complex gaming simulations interfaced with adaptive robots requiring integrated control of shoulder, elbow, forearm, wrist and finger movements...
- 10
- 477
- 0
báo cáo hóa học:" Integral representations for solutions of some BVPs for the Lame'''' system in multiply connected domains" docx
... (34)15 Integral representations for solutions of some BVPs for the Lam´e system in multiply connected domainsAlberto Cialdea∗1, Vita Leonessa1and Angelica Malaspina11Department of Mathematics ... of a reducing operator, which will be useful in the study of the integral system of the first kind arising in the Dirichlet problem.Section 4 is devoted to the case n = 2, where there exist some ... solution of the traction problem (50) if, and only if, the singular integral system (56) is solvable.On the other hand, there exists a solution γ ∈ [Lp(Σ)]n of the singular integral system 12γ...
- 30
- 404
- 0
Báo cáo sinh học: " Research Article Robust Stabilization of Fractional-Order Systems with Interval Uncertainties via Fractional-Order Controllers" potx
... EquationsVolume 2010, Article ID 984601, 15 pagesdoi:10.1155/2010/984601 Research Article Robust Stabilization of Fractional-Order Systems with Interval Uncertainties via Fractional-Order ControllersSaleh ... the uncertain fractional-order nonlinear systems with interval Jacobian matrix.4. Robust Stability of FO-LTI Interval SystemFrom previous section, for the robust stability check of the uncertain ... thecontrol of fractional-order interval nonlinear systems. Finally, numerical simulations are alsoprovided to show effectiveness of proposed controller in order to achieve robust stabilization of unstable...
- 15
- 290
- 0
Báo cáo sinh học: " Research Article Nodal Solutions for a Class of Fourth-Order Two-Point Boundary Value Problems" docx
... pagesdoi:10.1155/2010/570932 Research Article Nodal Solutions for a Class of Fourth-Order Two-Point Boundary Value ProblemsJia Xu1, 2and XiaoLing Han11Department of Mathematics, Northwest Normal University, Lanzhou ... AppliedMathematics and Computation, vol. 168, no. 2, pp. 1219–1231, 2005.9 R. Ma, Nodal solutions for a fourth-order two-point boundary value problem,” Journal of Mathematical Analysis and Applications, ... Applications, vol. 314, no. 1, pp. 254–265, 2006.10 R. Ma, Nodal solutions of boundary value problems of fourth-order ordinary differential equations,”Journal of Mathematical Analysis and Applications,...
- 11
- 286
- 0
Báo cáo sinh học: " Research Article Positive Solutions of nth-Order Nonlinear Impulsive Differential Equation with Nonlocal Boundary Conditions" potx
... Corporation Boundary Value ProblemsVolume 2011, Article ID 456426, 19 pagesdoi:10.1155/2011/456426 Research Article Positive Solutions of nth-Order Nonlinear Impulsive Differential Equation with Nonlocal Boundary ... introduction of the basic theory of impulsive differential equations, see Lakshmikantham et al. 1; for an overview of existing results and of recent research areas of impulsive differential equations, ... W. Ge, “Existence of solutions of boundary value problems with integral boundary conditions for second-order impulsive integro-differential equations in Banach spaces,”Journal of Computational...
- 19
- 261
- 0
Báo cáo hoa học: " Research Article Meromorphic Solutions of Some Complex Difference Equations" doc
... EquationsVolume 2009, Article ID 982681, 10 pagesdoi:10.1155/2009/982681 Research Article Meromorphic Solutions of Some Complex Difference EquationsZhi-Bo Huang and Zong-Xuan ChenSchool of Mathematical ... purpose of this paper is to present the properties of the meromorphic solutions of complex difference equations of the form{J}αJzj∈Jfz cj Rz, fz,where{J} isa collection of ... transcendental meromorphic solution of finite order, then degfRz, fz ≤ 2.Advances in Difference Equations 5Lemma 3.2. Given distinct complex numbers c1,c2, ,cn, a meromorphic function fz andmeromorphic...
- 10
- 225
- 0
Báo cáo sinh học: "India''''s ''''gold mine'''' of ancestral bacilli and the looming TB-HIV pandemic" potx
... CentralPage 1 of 2(page number not for citation purposes)Annals of Clinical Microbiology and AntimicrobialsOpen AccessEditorialIndia's 'gold mine' of ancestral bacilli and the looming ... a chunk of DNA whose presence determines the ancestral M. tuberculosis [3], a geno-family of possibly lowdisseminating strains as compared to some of the veryhighly spreading and expanding strains ... expanding strains such as the Beijingtypes [4,5]. Predominance of the ancestral strains possiblysuggests that India has been the ancient reservoir for TB in the continent [1]. The ancestral strains...
- 2
- 271
- 0
báo cáo khoa học: " Psychosocial and contextual correlates of opioid overdose risk among drug users in St. Petersburg, Russia" pot
... expressed interest in receiving training in overdose prevention and response.Conclusion: Opioid overdose experience is very common among drug users in St. Petersburg, Russia, and interest in receiving ... explored it in detail. In order to gain a clearerunderstanding of the situation, 60 drug users, both in and out of drug treatment in St. Petersburg, wereinterviewed concerning their overdose experience ... of their awareness of and concern about overdose risk. Drug users noted their lack of confidence in beingable to respond to overdose situations and were interested in receiving training on overdose...
- 11
- 328
- 0
Báo cáo sinh học: "Combined therapy with cyclophosphamide and DNA preparation inhibits the tumor growth in mice" docx
... purposes)Genetic Vaccines and Therapy Open AccessResearchCombined therapy with cyclophosphamide and DNA preparation inhibits the tumor growth in miceEkaterina A Alyamkina1, Evgenia V Dolgova1, ... injection, and they received 0.5 mg DNA during the interval between the two CP injections (30–40 minafter the first CP dose). The control groups in experiments1 and 5 were treated with saline instead ... and human DNA, comparing the regimens shown below with the con-trol (n = 6)Figure 3 Tumor growth (mean ± SEM) in mice treated with CP and human DNA, comparing the regimens shown below with the...
- 11
- 225
- 0
Báo cáo sinh học: " Restricted maximum likelihood estimation of genetic parameters for the first three lactations in the Montbéliarde dairy cattle breed" pptx
... h1 8" alt ="" Original article Restricted maximum likelihood estimation of genetic parameters for the first three lactations in the Montbéliarde dairy cattle breedC. BeaumontInstitut ... extensive. Therefore, in this part of the analysis, the fixed effects of the year-season of calving, of the ageat 1st calving and of the length of the preceding lactation ... (1987). The first data set consisted of the daughters of sampling bulls born in 1975 and the second of the daughters of sampling bulls born in 1976. For each of the 2...
- 14
- 212
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ