Báo cáo sinh học: " Integral representations for solutions of some BVPs for the Lame'''''''' system in multiply connected domains" pot

... learning approach that we use is that it is simpler and more general than that of Ando and Zhang (2005) and Suzuki and Isozaki (2008). Their methods dictate a particular choice of model and training ... the final NER F1 results. We compare to the state-of-the-art methods of Ando and Zhang (2005), Suzuki and Isozaki (2008), and for NER—Lin and Wu (2009). Tables 2 and 3 s...

Ngày tải lên: 20/02/2014, 04:20

... 2005, 36:186-192. doi:10.1186/1479-5876-9-20 Cite this article as: Stelzle et al.: Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser Surgery. Journal of Translational Medicine ... 1). Discussion For feedback controlled laser surgery, tissue differentia- tion is a crucial step. Especially in ora...

Ngày tải lên: 18/06/2014, 19:20

... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... 9:99 http://www.translational-medicine.com/content/9/1/99 Page 8 of 10 hyperplasia; HE: hematoxylin and eosin; iTRAQ: isobaric tags for relative and absolute quantification; PAP: pro...

Ngày tải lên: 18/06/2014, 19:20

... 36:257–303. 28 However these are not the only integral representations that are of importance. Another one consists in looking for the solution of the Dirichlet problem in the form of a simple layer potential. ... derivatives of a double layer potential. This leads to the construction of a reducing operator, which will be useful in the study of the integ...

Ngày tải lên: 18/06/2014, 22:20

... Access Review Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases Hervé Le Calvez* 1 , Mang Yu 2 and Fang Fang 2 Address: 1 Abgent, Inc. 6310 Nancy Ridge Drive, ... antibody indicated for prevention and treatment of respiratory syncytial virus (RSV) has heralded a new era for viral...

Ngày tải lên: 18/06/2014, 22:20

... Piano trainer kinematic analyses. a. Daily averages during Virtual Piano training for finger fractionation defined as the difference between the angle of the MCP joint of the cued finger and of the ... training. Our past work has used virtual reality gaming simulat ions to exercise finger movements of a stationary hand, includ- ing functional individual finger mot ions and...

Ngày tải lên: 19/06/2014, 08:20

... (34) 15 Integral representations for solutions of some BVPs for the Lam´e system in multiply connected domains Alberto Cialdea ∗1 , Vita Leonessa 1 and Angelica Malaspina 1 1 Department of Mathematics ... of a reducing operator, which will be useful in the study of the integral system of the first kind arising in the Dirichlet problem. Section...

Ngày tải lên: 20/06/2014, 04:20

... Equations Volume 2010, Article ID 984601, 15 pages doi:10.1155/2010/984601 Research Article Robust Stabilization of Fractional-Order Systems with Interval Uncertainties via Fractional-Order Controllers Saleh ... the uncertain fractional-order nonlinear systems with interval Jacobian matrix. 4. Robust Stability of FO-LTI Interval System From previous sec...

Ngày tải lên: 21/06/2014, 16:20

... pages doi:10.1155/2010/570932 Research Article Nodal Solutions for a Class of Fourth-Order Two-Point Boundary Value Problems Jia Xu 1, 2 and XiaoLing Han 1 1 Department of Mathematics, Northwest Normal University, Lanzhou ... Applied Mathematics and Computation, vol. 168, no. 2, pp. 1219–1231, 2005. 9 R. Ma, Nodal solutions for a fourth-order two-point...

Ngày tải lên: 21/06/2014, 16:20

... Corporation Boundary Value Problems Volume 2011, Article ID 456426, 19 pages doi:10.1155/2011/456426 Research Article Positive Solutions of nth-Order Nonlinear Impulsive Differential Equation with Nonlocal Boundary ... introduction of the basic theory of impulsive differential equations, see Lakshmikantham et al. 1; for an overview of existing results an...

Ngày tải lên: 21/06/2014, 16:20

... Equations Volume 2009, Article ID 982681, 10 pages doi:10.1155/2009/982681 Research Article Meromorphic Solutions of Some Complex Difference Equations Zhi-Bo Huang and Zong-Xuan Chen School of Mathematical ... purpose of this paper is to present the properties of the meromorphic solutions of complex difference equations of the form  {J} α J z  j∈J fz  c...

Ngày tải lên: 21/06/2014, 20:20

... Central Page 1 of 2 (page number not for citation purposes) Annals of Clinical Microbiology and Antimicrobials Open Access Editorial India's 'gold mine' of ancestral bacilli and the looming ... a chunk of DNA whose presence determines the ancestral M. tuberculosis [3], a geno-family of possibly low disseminating strains as compared to some of the...

Ngày tải lên: 08/08/2014, 19:20

... expressed interest in receiving training in overdose prevention and response. Conclusion: Opioid overdose experience is very common among drug users in St. Petersburg, Russia, and interest in receiving ... explored it in detail. In order to gain a clearer understanding of the situation, 60 drug users, both in and out of drug treatment in St. P...

Ngày tải lên: 11/08/2014, 18:20

... purposes) Genetic Vaccines and Therapy Open Access Research Combined therapy with cyclophosphamide and DNA preparation inhibits the tumor growth in mice Ekaterina A Alyamkina 1 , Evgenia V Dolgova 1 , ... injection, and they received 0.5 mg DNA during the interval between the two CP injections (30–40 min after the first CP dose). The control groups in e...

Ngày tải lên: 14/08/2014, 19:22

... h1 8" alt ="" Original article Restricted maximum likelihood estimation of genetic parameters for the first three lactations in the Montbéliarde dairy cattle breed C. Beaumont Institut ... extensive. Therefore, in this part of the analysis, the fixed effects of the year-season of calving, of the age at 1st calving and o...

Ngày tải lên: 14/08/2014, 20:20