Báo cáo sinh học: " Raman enhancement of rhodamine adsorbed on Ag nanoparticles self-assembled into nanowire-like arrays" docx

Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

... bicarbonate per mol total bicar- bonate. In the experiments, the total concentration of bicarbonate was 15 m M but the total concentration of NH 4 Clwas0.5 m M . So we defined a concentration of ... combined plot of the time dependence of the exogenous arginine concentrations for the 11 simula- tions described here. Each curve on this graph corresponds to the time-dependent concent...

Ngày tải lên: 08/03/2014, 08:20

9 438 0
Báo cáo y học: "Mechanical behaviour of standardized, endoskeleton-including hip spacers implanted into composite femurs"

Báo cáo y học: "Mechanical behaviour of standardized, endoskeleton-including hip spacers implanted into composite femurs"

... 7206-4. Determination of endurance properties of stemmed femoral components with application of torsion. ISO. 1989. 19. Viceconti M, Casali M, Massari B, Cristofolini L, Bassini S, Toni A. The ‘Standardized ... Fracture, Infection, Bone cement, Endoskeleton Introduction The application of a spacer made of antibiotic impregnated bone cement (PMMA) is a recom- mended treatment m...

Ngày tải lên: 26/10/2012, 09:53

7 362 0
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

... GGGGGACACCGCCCGTCGCTCCCCC PfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG PfSOD ... the effects of G6PD-6PGL silencing in P. falciparum, confirming the key role of this enzyme in the intraerythrocyte stage of infection. Results Effects of PfG6PD-6P...

Ngày tải lên: 19/02/2014, 07:20

10 437 0
Tài liệu Báo cáo khoa học: "The Impact of Query Refinement in the Web People Search Task" docx

Tài liệu Báo cáo khoa học: "The Impact of Query Refinement in the Web People Search Task" docx

... clusters of size >=3 son dataset in the WePS corpus contains a total of 100 documents, and 10 of them belong to a British politician named James Patterson. The WePS-2 corpus contains a total of ... Recognition Tool 3 we obtained the lists of persons, locations and organi- zations mentioned in each document. Additionally, we used attributes manually an- notated for the WePS-2 Attr...

Ngày tải lên: 20/02/2014, 09:20

4 460 0
Tài liệu Báo cáo khoa học: "The Effect of Pitch Accenting on Pronoun Referent Resolution" ppt

Tài liệu Báo cáo khoa học: "The Effect of Pitch Accenting on Pronoun Referent Resolution" ppt

... attentional salience. One determiner of whether attentional or propositional effects are dominant is the type of information provided by the accented constituent. Because nonpronominals contribute ... focus of attention. Intonational theories would be similarly hard pressed, but on grounds of information quality and efficient use of limited resources. Given the serial and...

Ngày tải lên: 20/02/2014, 22:20

3 548 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

... mRNA fractions. Titration of these two fractions indicated that Mcm2 mRNA is 4–8 times more abundant in the HeLa mRNA fraction than in the WI-38 fraction. In contrast, the concentration of glyceral- dehyde-3-phosphate ... anti-Mcm4 (second), anti-PCNA (third) and anti-Ki67 (fourth) Ig. (B) Sections containing part of the boundary of CIS (left portion) and dysplasia (CIN1 of FIGO cla...

Ngày tải lên: 20/02/2014, 23:20

13 487 0
Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot

Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot

... these conditions, hence the lack of reformation of POR-PChlide 650 . Addition of low concentrations of NADPH to PLB aged at pH 7.5 which show only limited structural reorganization, in contrast, results ... those of a physical dissociation of Chlide and/or conformational changes associated with the pH-dependent conversion of the enzyme from a more aggregated long-wavelength form...

Ngày tải lên: 22/02/2014, 04:20

11 638 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... than control pcDNA–HEK293 cells. Nontoxic concentra- tions of each polyphenol were used in combination with increasing concentrations of etoposide to deter- mine the effects of the polyphenols on ... GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGC ABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864...

Ngày tải lên: 07/03/2014, 21:20

16 517 0
Báo cáo Y học: IgE reactivity of tandem repeats derived from cockroach allergen, Bla g 1 docx

Báo cáo Y học: IgE reactivity of tandem repeats derived from cockroach allergen, Bla g 1 docx

... at different pH values. Only at pH 4, expression of rBla g 1 was as expected, with most of the protein containing two duplexes when observed by SDS/PAGE. At pH 3 there was no expression of rBla g 1, and ... suffered degradation and was broken down to the size of one duplex. Addition of 1 m M phenylmethanesulfonyl fluoride and EDTA to cultures at pH 6 slightly reduced the production...

Ngày tải lên: 08/03/2014, 23:20

7 282 0
Báo cáo khoa học: Functional association of human Ki-1⁄57 with pre-mRNA splicing events docx

Báo cáo khoa học: Functional association of human Ki-1⁄57 with pre-mRNA splicing events docx

... separation of the amplification products on 3% agarose gels containing ethidium bromide, the band intensities were calculated using the software image j (http://rsb.info.nih.gov/ij/index.html; National Institute ... plasmid concentrations used (Fig. 4C,D). Moreover, the effects seemed to be isoform specific for each Ki-1 ⁄ 57 region, as the formation of 10S mRNA was only increased by the...

Ngày tải lên: 16/03/2014, 02:20

14 369 0
w