Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx
Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf
... Automatic Part -of- Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario Sandipan Dandapat, Sudeshna Sarkar, Anupam Basu Department of Computer ... result instead of using only for rare words as is described in Ratnaparkhi (1996). This can be explained by the fact that due to small amount of annotated data, a significant number of instances ... et al. (1992), makes use of both labeled training text and some amount of unlabeled text. Incorporating a diverse set of overlapping features in a HMM-based tagger is difficult and complicates...
- 4
- 455
- 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"
... transplantation with stem cells has advantages of minimally invasive and simple manipulation. There-fore, in recent years, a lot of physicians apply stem cell transplantation in the treatment of ... transplantation has been a common strategy in the stem cell transplantation and researchers have applied it in the treatment of a lot of diseases including severe autoimmune diseases (systemic ... brain, lungs, heart, kidney, intestine, hip joints and other organs at 24 h after transplantation. At 48 h after transplantation, the amount of MSCs in tissues gradually decreased, and nearly...
- 10
- 584
- 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes
... Collaboration THS. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA. 2002; 288: 2015-22. 7. Wald DS, Law M, Morris JK. Homocysteine and cardiovascular disease: ... IJ, et al. Hyperhomocystein-aemia, Helicobacter pylori, and coronary heart disease. Heart. 1997; 78: 524. 16. Saxena V, Markus H, Swaminathan S, et al. Hyperhomocys-teinaemia, Helicobacter ... Huotari K, et al. Prevalence of low vitamin B12 and high homocysteine in serum in an elderly male popula-tion: association with atrophic gastritis and Helicobacter pylori infection. Scand J Gastroenterol....
- 7
- 578
- 1
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx
... Toshiko Maeta and Taka-shi Nakamura for their technical assistance. Drs Kazu-hito Naka (Kanazawa University) and Yasuo Ariumi(Okayama University) are also thanked for theirvaluable input in this ... TRIF-mediated signaling path-way in HeLa cells. Fig. S2. NS3- 4A is capable of cleaving Cardif, but notTRIF in HeLa cells. Table S1. Quantitative RT-PCR analysis of mRNAexpression of several factors ... aremediated by the host and virally encoded serine prote-ase located in the amino-terminal domain of NS3. Ser-ine protease activity of NS3 requires NS 4A, a proteinconsisting of 54 amino acid...
- 16
- 523
- 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
... Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G. AvadhaniDepartment of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USACytochrome ... FEBSMitochondrial targeting of intact CYP2B1 and CYP2E1 andN-terminal truncated CYP 1A1 proteins in Saccharomycescerevisiae)role of protein kinase A in the mitochondrialtargeting of CYP2E1Naresh ... Dasari VR, Anandatheerthavarada HK, Robin MA,Boopathi E, Biswas G, Fang JK, Nebert DW &Avadhani NG (2006) Role of protein kinase C-mediatedprotein phosphorylation in mitochondrial translocationof...
- 16
- 650
- 0
Tài liệu Báo cáo khoa học: ATPase activity of magnesium chelatase subunit I is required to maintain subunit D in vivo ppt
... when ADP was usedinstead of ATP (Fig. 4B).Presence of Xantha-gmRNA in xantha-hmutants A possible explanation for the absence of 70 kDa XAN-Gprotein in the xantha-h mutants could be that the ... the XAN-Hprotein affects the level of Xantha-g mRNA. Therefore,the presence of Xantha-g mRNA was analysed in onesemidominant and one recessive xantha-h mutant (Xantha-hclo 157and xantha-h57, ... domain of BchD into contactwith the integrin-binding motif of BchH, simultaneouslytriggering porphyrin metallation. This would also lead to a release of the blockade of the ATP-binding site of...
- 7
- 475
- 0
Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf
... (sense)5¢-TAATCTTCCTCAGTATAGAGGGGTGAACATTCGGAGATTGCTCAACGGTAGCAT CGTGGTCAA GAACGATGTCATCTTCCGAGA AGGTTACA CTT TAGAGCACGAC-3¢ and M12FREG-R (antisense) 5¢-GTGCTCTAAAGTGTAACCTTCTCGGAAGAT GACATCGTT ... poly-linker. SEALINK1 (sense) 5 ¢-CTACTGGACTAGTGAATTCCTCGAGCCAGTCTG-3¢ and SEALINK2 (antisense)5¢- AGACTGGCT CGAGGA ATTCAC TAGTCCA GTAGA-3 ¢were annealed and directly cloned into the XcmI site of MUC1FDTR. ... 5¢-GTTCAGGCCAGCATCTGTGGTGGTACAATTG-3¢ (sense), 5¢ -CAATTGTACCACCACAGATGCTGGCCTGAAC-3¢ (antisense),S ⁄ A substitution: 5¢-GTTCAGGCCAGGAGCTGTGGTGGTACAATTG-3¢ (sense), 5¢-CAATTGTACCACCACAGCTCCTGGCCTGAAC-3¢ (antisense),...
- 11
- 605
- 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc
... Snapshot of a key intermediate in enzymaticthiamin catalysis: Crystal structure of the a- carbanion of (a, b-dihydroxyethyl) -thiamin diphosphate in the active site of transketolase from Saccharomyces ... octahedrally coordinated to oxygenatoms from the diphosphate group of ThDP, the sidechains of Asp435 and Asn462, the main chain oxygen atom of Gly464, and a water molecule. All these interactions ... Molecular cloning and characterization of aldehyde oxidases in Arabidopsis thaliana. Plant Cell Physiol. 39,433–442.8. Koga, J., Adachi, T. & Hidaka, H. (1991) Molecular cloning of thegene...
- 10
- 557
- 0
Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt
... aca 70% 104 2.7E53V gaa fi gta 90% 150 4E53V ⁄ K56R gaa fi gta 90% 154 4.1aaa fi agaVariants of second generationE53V ⁄ K56R ⁄ C23S gaa fi gta 120% a 1600 42aaa fi agatgt fi agt a Residual activity ... herein, takes into account the inhibitionTable 2. Characteristics of FDH variants with increased activitytowards acrylamide (AA) ⁄ TEMED. Percentage values of half-life(t1 ⁄ 2) are related ... min of incubation, a gas sam-ple of 100 lL was withdrawn from the headspace with a gas-tight syringe, injected into a GC ⁄ HCD (Perkin Elmar,Connecticut, USA) and analysed isothermally at 40...
- 8
- 377
- 0
Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc
... vitamin K1as the s tandard. MK4(Sigma; c at. no. V-937 8) and v itamin K1(Fluka; cat. no.95271) are commercially available.Activities of Psr and of polysul®de respirationThe activity of ... wasincorporated instead, the activity was as low as that o fproteoliposomes p repared w ithout added quinone. I nliposomes containing fumarate reductase and hydrogenase,fumarate respiration ... location of Psr in themembrane which contains half of the total cellular protein. In contrast, the speci®c activities of polysul®de respirationare higher in cells than in the membrane fraction...
- 10
- 490
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtisolation of multipotent mesenchymal stem cells from umbilical cord bloodseeding and encapsulation of human mesenchymal stem cells in pec fibersbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ