Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx

Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

... Automatic Part -of- Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario Sandipan Dandapat, Sudeshna Sarkar, Anupam Basu Department of Computer ... result instead of using only for rare words as is described in Ratnaparkhi (1996). This can be explained by the fact that due to small amount of annotated data, a significant...

Ngày tải lên: 31/03/2014, 01:20

4 455 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

... transplantation with stem cells has advantages of minimally invasive and simple manipulation. There- fore, in recent years, a lot of physicians apply stem cell transplantation in the treatment of ... transplantation has been a common strategy in the stem cell transplantation and researchers have applied it in the treatment of a lot of diseases includ...

Ngày tải lên: 25/10/2012, 11:18

10 584 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

... Collaboration THS. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA. 2002; 288: 2015-22. 7. Wald DS, Law M, Morris JK. Homocysteine and cardiovascular disease: ... IJ, et al. Hyperhomocystein- aemia, Helicobacter pylori, and coronary heart disease. Heart. 1997; 78: 524. 16. Saxena V, Markus H, Swaminathan S, et al. Hyperhomocys- teinaemia, Helicobacte...

Ngày tải lên: 31/10/2012, 14:34

7 579 1
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

... Toshiko Maeta and Taka- shi Nakamura for their technical assistance. Drs Kazu- hito Naka (Kanazawa University) and Yasuo Ariumi (Okayama University) are also thanked for their valuable input in this ... TRIF-mediated signaling path- way in HeLa cells. Fig. S2. NS3- 4A is capable of cleaving Cardif, but not TRIF in HeLa cells. Table S1. Quantitative RT-PCR analysis of mRNA expre...

Ngày tải lên: 18/02/2014, 16:20

16 524 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G. Avadhani Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA Cytochrome ... FEBS Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP 1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: ATPase activity of magnesium chelatase subunit I is required to maintain subunit D in vivo ppt

Tài liệu Báo cáo khoa học: ATPase activity of magnesium chelatase subunit I is required to maintain subunit D in vivo ppt

... when ADP was used instead of ATP (Fig. 4B). Presence of Xantha-g mRNA in xantha-h mutants A possible explanation for the absence of 70 kDa XAN-G protein in the xantha-h mutants could be that the ... the XAN-H protein affects the level of Xantha-g mRNA. Therefore, the presence of Xantha-g mRNA was analysed in one semidominant and one recessive xantha-h mutant (Xantha- h clo 1...

Ngày tải lên: 19/02/2014, 12:20

7 475 0
Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf

Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf

... (sense) 5¢-TAATCTTCCTCAGTATAGAGGGGTGAACATTCG GAGATTGCTCAACGGTAGCAT CGTGGTCAA GAAC GATGTCATCTTCCGAGA AGGTTACA CTT TAGAGCA CGAC-3¢ and M12FREG-R (antisense) 5¢-GTGCTCTAA AGTGTAACCTTCTCGGAAGAT GACATCGTT ... poly- linker. SEALINK1 (sense) 5 ¢-CTACTGGACTAGTGAA TTCCTCGAGCCAGTCTG-3¢ and SEALINK2 (antisense) 5¢- AGACTGGCT CGAGGA ATTCAC TAGTCCA GTAGA-3 ¢ were annealed and directly cloned into the XcmI...

Ngày tải lên: 19/02/2014, 18:20

11 605 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... Snapshot of a key intermediate in enzymatic thiamin catalysis: Crystal structure of the a- carbanion of (a, b-dihydroxyethyl) -thiamin diphosphate in the active site of transketolase from Saccharomyces ... octahedrally coordinated to oxygen atoms from the diphosphate group of ThDP, the side chains of Asp435 and Asn462, the main chain oxygen atom of Gly464, and a water m...

Ngày tải lên: 20/02/2014, 11:20

10 558 0
Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt

Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt

... aca 70% 104 2.7 E53V gaa fi gta 90% 150 4 E53V ⁄ K56R gaa fi gta 90% 154 4.1 aaa fi aga Variants of second generation E53V ⁄ K56R ⁄ C23S gaa fi gta 120% a 1600 42 aaa fi aga tgt fi agt a Residual activity ... herein, takes into account the inhibition Table 2. Characteristics of FDH variants with increased activity towards acrylamide (AA) ⁄ TEMED. Percentage values of half-life (t 1 ⁄ 2 )...

Ngày tải lên: 16/03/2014, 13:20

8 377 0
Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc

Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc

... vitamin K 1 as the s tandard. MK 4 (Sigma; c at. no. V-937 8) and v itamin K 1 (Fluka; cat. no. 95271) are commercially available. Activities of Psr and of polysul®de respiration The activity of ... was incorporated instead, the activity was as low as that o f proteoliposomes p repared w ithout added quinone. I n liposomes containing fumarate reductase and hydrogenase, fumarate respirat...

Ngày tải lên: 24/03/2014, 03:21

10 490 0
w