Ngày tải lên: 23/03/2014, 14:20
... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D....
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCC GGCCTTGCTGGCTACGTTG F-TDPX1 Cys64Ala GGTACTGGCGTTCCCG GCCAACCAGTTCGCCGGTC R-TDPX1 Cys64Ala GACCGGCGAACTGGTT GGCCGGGAACGCCAGTACC F-TDPX1 Cys83Ala AGGTGAAAAGTTT...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan). Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis sys- tem (Agilent Technologies, ... This analysis of microarray data revealed a striking similar- ity of gene clusters among AT-MSC-Hepa, primary hepatocytes and human liver. This indicates that AT-MSC-Hepa...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc
... the supernatant fraction containing soluble mtDNA replication factors (fraction II) was recovered and stored at 3 °C. Relaxation and catenation assays for DNA topisomerase II activity Each relaxation ... agarose-gel assays are shown. Relaxed and supercoiled (sc) forms of the plasmid DNA are as labeled. (A) Time course. Standard agarose-gel, relaxation assays contained 20 ng of fr...
Ngày tải lên: 31/03/2014, 07:20
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... sequences for the mRNA of b-catenin were 5¢-AAAGCTGATATTGATGGACAG-3¢. The siRNA against luciferase mRNA was used as a control siRNA. The target sequence for luciferase mRNA was 5¢-AACG TACGCGGAATACTTCGA-3¢. ... Flight Attendant Medical Research Institute grants 032040 and 072104, and American Heart Association Greater Southeast Affiliate grants 0555322B and 0855338E. References...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc
... 39th Annual Conference on Association of Computational Linguistics (ACL), 124-131. E. Charniak, K. Knight and K. Yamada. 2003. Syntax- based language models for statistical machine transla- tion. ... use its approximation, a linear com- bination of 5-gram/2-SLM and 2-gram/4-SLM, and for 5-gram/2-SLM or 2-gram/4-SLM, again we cut off its fractional expected counts that are less...
Ngày tải lên: 20/02/2014, 04:20
Báo cáo khoa học: "Task-oriented Evaluation of Syntactic Parsers and Their Representations" potx
... Klein, 2007), but also include dependency parsers (Mc- Donald and Pereira, 2006; Nivre and Nilsson, 2005; Sagae and Tsujii, 2007) and deep parsers (Kaplan et al., 2004; Clark and Curran, 2004; Miyao and Tsujii, ... statistical features in a machine learning classifier (Yakushiji et al., 2005; Katrenko and Adriaans, 2006; Erkan et al., 2007; Sætre et al., 2007). PPI identificatio...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "A Freely Available Morphological Analyzer, Disambiguator and Context Sensitive Lemmatizer for German" pdf
... wundern, wund Table 3: Word forms with several lemmata. Conclusions In this paper, a freely available integrated tool for German morphological analysis, part -of- speech tagging and context sensitive ... sensitive lemmatiza- tion was introduced. The morphological ana- lyzer is based on the standard Duden grammar and provides wide coverage due to a lexicon of 324,000 word fo...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"
... 76-year-old man with a coarctation of the aorta. Cardiology 1999, 92:284-286. 8. Bauer M, Alexi-Meskishvili V, Bauer U. Benefits of surgical repair of coarctation of the aorta in patients older ... York: McGraw Hill Professional; 2004:1866. 4. Campbell M. Natural history of coarctation of the aorta. Br Heart J 1970, 32:633-640. 5. Jenkins NP, Ward AR. Coarctation of the...
Ngày tải lên: 25/10/2012, 11:40