Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx

Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx

Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx

... 9:91 http://www.translational-medicine.com/content/9/1/91 Page 6 of 8 RESEARCH Open Access Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage Josyf C Mychaleckyj 1* , Emily A Farber 1 , ... remain viable as a DNA source for highly multiplexed genome-wide genetic...

Ngày tải lên: 18/06/2014, 19:20

8 370 0
báo cáo hóa học:" Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" doc

báo cáo hóa học:" Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" doc

... remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage. Journal of Translational Medicine 2011 9:91. Mychaleckyj et al. Journal of Translational ... 9:91 http://www.translational-medicine.com/content/9/1/91 Page 8 of 8 RESEARCH Open Access Buffy coat specimens remain viable as a DNA source for h...

Ngày tải lên: 20/06/2014, 04:20

8 453 0
Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc

Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc

... manuscript. All authors read and approved the final manuscript. Authors’ information The International Acute Care Research Collaborative (IACRC), located within the University of Maryland Global ... acute care was once again crowded off the agenda. The recently released UN Report of the Secretary-General on the prevention and control of NCDs [1] aggressively attacked acute care...

Ngày tải lên: 18/06/2014, 18:20

5 274 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

... their identity. Data collection and Statistical analysis Real time PCR data was assembled using the LightCycler computer application software 4.05 dedicated for the LightCycler 2.0. All data was analyzed ... 04688945001 TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat. No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (Roche Diagnostic...

Ngày tải lên: 18/06/2014, 22:20

9 460 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... Absence Cyanidium caldarium Chloroplast DNA Absence Absence Presence 45% (2e)30) Absence Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA ? ? Absence Presence 35% (4e)10) Chloroplast DNA Absence ... Absence Chloroplast DNA Absence Absence Absence Absence Higher plant Oryza sativa Nuclear DNA Presence 82% (1e)88) Presence 69% (2e)44) Absence Absence Chloroplast DNA...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
báo cáo sinh học:" Building capacity without disrupting health services: public health education for Africa through distance learning" pot

báo cáo sinh học:" Building capacity without disrupting health services: public health education for Africa through distance learning" pot

... pro- gramme has played for health professionals who have engaged in it. For example, a feature that was repeatedly raised in a formative qualitative evaluation of South Afri- can students' ... to monitor what I'm doing because I'm working as a manager, as a trainer, as a capacity builder – so now that I'm doing this programme, I'm able to look at [...

Ngày tải lên: 18/06/2014, 17:20

8 369 0
báo cáo sinh học:" Improving pneumonia case-management in Benin: a randomized trial of a multi-faceted intervention to support health worker adherence to Integrated Management of Childhood Illness guidelines" doc

báo cáo sinh học:" Improving pneumonia case-management in Benin: a randomized trial of a multi-faceted intervention to support health worker adherence to Integrated Management of Childhood Illness guidelines" doc

... diagnosis, which was excluded from the multivariate analysis because it was considered a causal pathway variable, was strongly associ- ated with recommended treatment (Table 2, last row). For ... that caseload was inversely associated with consultation time, with the association being strongest at caseloads over 50 per day, and that quality of care was highest in the areas where health wo...

Ngày tải lên: 18/06/2014, 17:20

13 513 0
báo cáo sinh học:" Developing capacity in health informatics in a resource poor setting: lessons from Peru" pptx

báo cáo sinh học:" Developing capacity in health informatics in a resource poor setting: lessons from Peru" pptx

... Libraries) and laboratory informatics. The collaborative program has made available a range of informatics applications (i.e. public health, medical, and bio-informatics) and offers training opportunities ... Global Research Initiative Program (GRIP) grant [18]. At UPCH, AMAUTA has forged ongoing and novel part- nerships between trainees and librarians to develop sus- tainable databases and...

Ngày tải lên: 18/06/2014, 17:20

5 364 0
báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc

báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc

... health system. This had a direct effect on program performance, particularly on all aspects of TB case management, TB case notifica- tion, and the quality of surveillance. Management for HRD at ... not for citation purposes) ment (USAID) and Canadian International Development Agency (CIDA). Later funding was through the Global Fund for Aids, Tuberculosis and Malaria (GFATM, now GF)....

Ngày tải lên: 18/06/2014, 17:20

9 418 0
báo cáo sinh học:" Reflections on the ethics of recruiting foreigntrained human resources for health" pptx

báo cáo sinh học:" Reflections on the ethics of recruiting foreigntrained human resources for health" pptx

... Institute for Health Information: International Medical Graduates in Canada: 1972 to 2007. Ottawa 2009. 4. Health Canada: Pan-Canadian Health Human Resource Strategy. 2007-2008 Annual Report. Ottawa ... Labonté R, Sanders D, Baum F, Schaay N, Packer C, Laplante D, Vega- Romero R, Viswanatha V, Barten F, Hurley C, Ali HT, Manolakos H, Acosta- Ramírez N, Pollard J, Narayan T, Mohamed S, Peper...

Ngày tải lên: 18/06/2014, 17:20

11 703 0
w