Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt

... Sidransky D: DNA methylation markers in colorectal cancer. Cancer Metastasis Rev 2010, 29:181-206. Figure 6 Changes in intracellular localization according to KIAA0247 expression and 5-FU treatment. ... 9:82 http://www.translational-medicine.com/content/9/1/82 Page 2 of 8 RESEARCH Open Access A predicted protein, KIAA0247, is a cell cycle modulator in colorecta...

Ngày tải lên: 18/06/2014, 19:20

... Sidransky D: DNA methylation markers in colorectal cancer. Cancer Metastasis Rev 2010, 29:181-206. Figure 6 Changes in intracellular localization according to KIAA0247 expression and 5-FU treatment. ... Capdevila J, Saura C, Tabernero J: Novel targets for anticancer treatment development in colorectal cancer. Clin Colorectal Cancer 2006, 6:265-272. 7. Voutsadakis IA: Patho...

Ngày tải lên: 20/06/2014, 03:20

... the activity detected can be attributed mainly to catalases. Total catalase activity was determined in leaves and flowers from AtFH-deficient lines. In both lines, a decrease of 20% in catalase activity ... to the total catalase activity (Fig. 6A) . In agreement with the data shown in Fig. 5A, we also observed a decrease in catalase activity in Arabidopsis cells. On the othe...

Ngày tải lên: 28/03/2014, 23:20

... health unit personnel reasons for characterizing the contracting mechanism as advantageous or disadvantageous Category Reasons Somewhat advantageous 1. Salary and benefits drawbacks 2. Cannot accumulate ... effect. This purpose of the audit is to understand the change in performance and is based on a review of patient charts maintained by health personnel. A systematic monthly audit...

Ngày tải lên: 18/06/2014, 17:20

... all, β-actin is an unsuitable as reference gene, whereas TATA-Box binding protein and peptidyl-prolyl-isomerase A are stable reference genes for expression studies in virus infected cells. Background Quantitative ... last position, indicating that it is an unsuitable reference gene in virus infected cells. The actin gene shows significant variations with increasing degree of infe...

Ngày tải lên: 18/06/2014, 22:20

... and Aurora -A kinase. (D) Low power (2×) image of ovarian tissue microarray stained for Aurora A by immunohistochemistry. (E) Aurora -A staining of TMA core of ovarian carcinoma without adjuvant ... of total cells positive for Aurora -A, and data averaged for each patient's cores. The TMA staining data, including detailed patient information is summarized in Table 3. On aver-...

Ngày tải lên: 18/06/2014, 15:20

... clinical data of patients and performed statistical data analysis. AJ and TK coordinated the study and were involved in drafting the manuscript and revised it critically. All authors read and approved ... coordinated immunohistochemical examinations of tumor specimens and data analysis, and drafted the manuscript. DH participated in the interpretation of data and conducted immunohistochem...

Ngày tải lên: 18/06/2014, 16:20

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAA...

Ngày tải lên: 19/02/2014, 05:20

... Itoh H, Naganuma S, Takeda N, Miyata S, Uchinok- ura S, Fukushima T, Uchiyama S, Tanaka H, Nagaike K, Shimomura T et al. (2004) Regeneration of injured intestinal mucosa is impaired in hepatocyte ... Okino T, Egami H, Ohmachi H, Takai E, Tamori Y, Nakagawa A, Nakano S, Sakamoto O, Suda T & Ogawa M (1991) Immunohistochemical analysis of dis- tribution of RON receptor tyrosine kinase...

Ngày tải lên: 29/03/2014, 23:20

... Madura K (1998) Rad23 links DNA repair to the ubiquitin ⁄ proteasome pathway. Nature 391, 715–718. 23 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maekawa T, Tanaka K, Hoeijmakers JH & Hanaoka F ... apoptosis. In this study, we identified two distinct domains in the N-terminal region of Scythe capable of binding Xrpn10c redun- dantly: Domain I and Domain II. Domain I contains a typical...

Ngày tải lên: 30/03/2014, 11:20