Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

... Gohda E, Nakayama H, Takahashi K, Sakiyama O, Miyazaki H, Sugihara J, Tomita E, Muro Y, Daikuhara Y, Hashimoto S: Clinical significance of human hepatocyte growth factor in blood from patients with ... Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S, Daikukhara Y: Purification and partial characterization of hepatocyte growth factor from plasma of patients wi...

Ngày tải lên: 18/06/2014, 19:20

... ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com- pared to insulin-treated ... psychometric properties of the 20-item insulin treatment appraisal scale (ITAS) in both insulin naïve and insulin-treated type 2 diabetes patients. Factor analyses...

Ngày tải lên: 18/06/2014, 22:20

... ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com- pared to insulin-treated ... psychometric properties of the 20-item insulin treatment appraisal scale (ITAS) in both insulin naïve and insulin-treated type 2 diabetes patients. Factor analyses...

Ngày tải lên: 20/06/2014, 16:20

... electrocardiogram, echocardiography, chest X-ray, triple -phase abdominal computed tomography with intravenous and oral con- trast, pulmonary function tests, and arterial blood gas analysis. Intraoperative data (warm ... performed, including baseline clinical data (demographics, medical history, current medication), physical examination, laboratory examina- tions, infection screening...

Ngày tải lên: 18/06/2014, 22:20

... Management Team) for their assistance in study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage- ment and data entry assistance. We acknowledge ... material Acknowledgements The authors thank our study participants for their support and coopera- tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and...

Ngày tải lên: 18/06/2014, 17:20

... (5'CTCGGCATGG ACGAGCTGTACAAGAAGTT- GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC 3'). This fragment included 24 nucleotides from the carboxi-terminal ... obtained after RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10...

Ngày tải lên: 18/06/2014, 18:20

... respirator, monitors, and clinical data from the charts on diagnosis and use of sedatives and hemodynamic treatments. The mismatch between human ability and the vast amount of data and information ... robustness and reliability, and industry to finalize a product that will receive a European Community marking (CE mark) and a U.S. marking (Food and Drug Ad...

Ngày tải lên: 18/06/2014, 18:20

... preliminary human and animal trials have shown it to be effective in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination ... currently available for OA, individualized treatment programs are available to help relieve pain and stiffness, and to maintain and/ or improve func- tional status...

Ngày tải lên: 26/10/2012, 09:48

... ≤40°C. Evaluation of replication of viruses in AGMs and efficacy against challenge AGMs in groups of two to four animals at a time were inoculated intranasally (i.n.) and intratracheally (i.t.) with ... the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical anal...

Ngày tải lên: 18/06/2014, 18:20