Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

... Gohda E, Nakayama H, Takahashi K, Sakiyama O, Miyazaki H, Sugihara J, Tomita E, Muro Y, Daikuhara Y, Hashimoto S: Clinical significance of human hepatocyte growth factor in blood from patients with ... Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S, Daikukhara Y: Purification and partial characterization of hepatocyte growth factor from plasma of patients wi...

Ngày tải lên: 18/06/2014, 19:20

12 567 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx

báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx

... ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com- pared to insulin-treated ... psychometric properties of the 20-item insulin treatment appraisal scale (ITAS) in both insulin naïve and insulin-treated type 2 diabetes patients. Factor analyses...

Ngày tải lên: 18/06/2014, 22:20

7 604 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf

báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf

... ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com- pared to insulin-treated ... psychometric properties of the 20-item insulin treatment appraisal scale (ITAS) in both insulin naïve and insulin-treated type 2 diabetes patients. Factor analyses...

Ngày tải lên: 20/06/2014, 16:20

7 485 1
Báo cáo sinh học: "Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" doc

Báo cáo sinh học: "Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" doc

... electrocardiogram, echocardiography, chest X-ray, triple -phase abdominal computed tomography with intravenous and oral con- trast, pulmonary function tests, and arterial blood gas analysis. Intraoperative data (warm ... performed, including baseline clinical data (demographics, medical history, current medication), physical examination, laboratory examina- tions, infection screening...

Ngày tải lên: 18/06/2014, 22:20

10 452 0
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot

báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot

... Management Team) for their assistance in study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage- ment and data entry assistance. We acknowledge ... material Acknowledgements The authors thank our study participants for their support and coopera- tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and...

Ngày tải lên: 18/06/2014, 17:20

10 502 0
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx

Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx

... (5'CTCGGCATGG ACGAGCTGTACAAGAAGTT- GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC 3'). This fragment included 24 nucleotides from the carboxi-terminal ... obtained after RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10...

Ngày tải lên: 18/06/2014, 18:20

16 428 0
Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot

Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot

... respirator, monitors, and clinical data from the charts on diagnosis and use of sedatives and hemodynamic treatments. The mismatch between human ability and the vast amount of data and information ... robustness and reliability, and industry to finalize a product that will receive a European Community marking (CE mark) and a U.S. marking (Food and Drug Ad...

Ngày tải lên: 18/06/2014, 18:20

26 436 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

... preliminary human and animal trials have shown it to be effective in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination ... currently available for OA, individualized treatment programs are available to help relieve pain and stiffness, and to maintain and/ or improve func- tional status...

Ngày tải lên: 26/10/2012, 09:48

10 706 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

... ≤40°C. Evaluation of replication of viruses in AGMs and efficacy against challenge AGMs in groups of two to four animals at a time were inoculated intranasally (i.n.) and intratracheally (i.t.) with ... the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical anal...

Ngày tải lên: 18/06/2014, 18:20

13 504 0
w