Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
... Gohda E, Nakayama H, Takahashi K, Sakiyama O,Miyazaki H, Sugihara J, Tomita E, Muro Y, Daikuhara Y, Hashimoto S: Clinical significance of human hepatocyte growth factor in blood from patients with ... Sakiyama O, Takahashi K,Miyazaki H, Hashimoto S, Daikukhara Y: Purification and partialcharacterization of hepatocyte growth factor from plasma of patients with fulminant hepatic failure. J Clin Invest ... Morishita R, Aoki M, Hashiya N, Makino H, Yamasaki K, Azuma J, Sawa Y,Matsuda H, Kaneda Y, Ogihara T: Safety evaluation of clinical genetherapy using hepatocyte growth factor to treat peripheral arterialdisease....
- 12
- 567
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... ITAS itemsare shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com-pared to insulin-treated ... psychometricproperties of the 20-item insulin treatment appraisal scale(ITAS) in both insulin naïve and insulin-treated type 2diabetes patients. Factor analyses suggest a simple two- factor structure, with items ... 8 and 17) pertaining to improvedTable 2: Exploratory factor analyses of the 20 items of the ITAS: forced 2-, 3- and 4 -factor solution after Oblimin rotation. Only factor loading > 0.40 are...
- 7
- 602
- 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf
... ITAS itemsare shown in Table 3, for insulin-naïve and insulin-treated patients. The mean total ITAS score of the insulin-naïve patients was about one standard deviation higher com-pared to insulin-treated ... psychometricproperties of the 20-item insulin treatment appraisal scale(ITAS) in both insulin naïve and insulin-treated type 2diabetes patients. Factor analyses suggest a simple two- factor structure, with items ... 8 and 17) pertaining to improvedTable 2: Exploratory factor analyses of the 20 items of the ITAS: forced 2-, 3- and 4 -factor solution after Oblimin rotation. Only factor loading > 0.40 are...
- 7
- 485
- 1
Báo cáo sinh học: "Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" doc
... electrocardiogram,echocardiography, chest X-ray, triple -phase abdominalcomputed tomography with intravenous and oral con-trast, pulmonary function tests, and arterial blood gasanalysis. Intraoperative data (warm ... performed, including baseline clinical data (demographics, medical history, currentmedication), physical examination, laboratory examina-tions, infection screening, urinalysis, electrocardiogram,echocardiography, ... undergoadditional screening v isits or clinical investigations in addition to standard pre-transplant work-up. Standa rd- of- care examinations for patients on the Liver Trans-plant Waiting List will...
- 10
- 451
- 0
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... Management Team) for their assistance in study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage-ment and data entry assistance. We acknowledge ... materialAcknowledgementsThe authors thank our study participants for their support and coopera-tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health ... Grundmann N, Gaolathe T,Puvimanasinghe J, et al.: Five-year outcomes of initial patients treated in Botswana's National Antiretroviral TreatmentProgram. AIDS 2008, 22(17):2303-11.2. Ferradini...
- 10
- 501
- 0
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... (5'CTCGGCATGG ACGAGCTGTACAAGAAGTT-GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCCAAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTAGAGAC 3'). This fragment included 24 nucleotides fromthe carboxi-terminal ... obtained after RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10 and are represented in all ... studies and helped with the ELISA anal-ysis; PJO performed neutralization plaque assays and dataanalysis; MSF discussed and assisted in animal studies; CFK designed flow cytometry analysis and...
- 16
- 428
- 0
Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot
... respirator, monitors, and clinical data from the charts on diagnosis and use of sedatives and hemodynamic treatments. The mismatch between human ability and the vast amount of data and information ... robustness and reliability, and industry to finalize a product that will receive a European Community marking (CE mark) and a U.S. marking (Food and Drug Administration (FDA)) approval. Generation and ... data to refine the ECP. The versatility and the ease in upgrading and adjusting the ECP are probably key factors in making ECP widely accepted; 3) The manufacturers are unfortunately not ready...
- 26
- 435
- 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... preliminary human and animal trials have shown it to be effective in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination ... currently available for OA, individualized treatment programs are available to help relieve pain and stiffness, and to maintain and/ or improve func-tional status. In the last few years, various ... Use of other natural health products, including glucosamine and chondroitin, one month prior to study and during the study, other than multivitamin and mineral supplements containing vitamins and...
- 10
- 706
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... ≤40°C.Evaluation of replication of viruses in AGMs and efficacy against challengeAGMs in groups of two to four animals at a time wereinoculated intranasally (i.n.) and intratracheally (i.t.) with ... the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis. We also thank Brad Finneyfrock ... formal demonstration in a clinical trial using clinical grade virus preparations.Evaluation of the two vaccine candidates revealed thatthey are reasonable candidates for further study in clinical trials....
- 13
- 504
- 0
Từ khóa: báo cáo sinh học haybáo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP