Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

... 9:36http://www.translational-medicine.com/content/9/1/36Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusHaddad et al.Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusDana Haddad1,2†, Nanhai ... article as: Haddad et al.: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus. Journal of...

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

... 9:36http://www.translational-medicine.com/content/9/1/36Page 3 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusHaddad et al.Haddad ... RESEARC H Open Access Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusDana Haddad1,2†, ... article as: Haddad et al.: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus. Journal of...

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... oli-gonucleotides: For the NL4-3 vpu TM region, NL-TM-F,CATGGAGATGCAACCTATAATAGTAGCAATAGTAG-CATT AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; ... NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG ... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. The cytoplasmicdomains were PCR amplified using...

Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

... used for UL132: 5'-TACACCCT-GTCACCGAA AGC-3' (forward); 5'-CTGATCGCGG-TAGTTTACTC-3' (forward); and 5'-TCACGAACGACGTGTCCAAG-3' (reverse).Northern analysisNorthern ... used for the Portland specimens for the same regionwere 5'-GCTTAAGCCAATCGCAGCGAGC-3' and 5'-GTCGCCTCGGTAGCTCAGTAGC-3'. The amplification proto-cols were the same as described ... conceived the study, analyzed the data from the Chi-cago site, and drafted the manuscript. SC contributed to the design of the study, analyzed the data from the Port-land site, and helped to draft the...

Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

... Sdc4:forward, 5¢-GCGGCTCGGATGACTTTG-3¢; reverse, 5¢-AAGGGCTCAATCACTTCAGG-3¢. Cib3: forward, 5¢-ATGACTTCAACAATGACAACTAC-3¢; reverse, 5¢-ATCCAGCACCTTCTCACAG-3¢. Cyp 4a1 0 ⁄ 31: forward, 5¢-GCCTCTGTGCTCGGTCTG-3¢; ... 5¢-AGCCTTGAGTAGCCATTGCC-3¢. Cyp2c39: forward 5¢-TGCTCTCCTACTCCTGATGAAG-3¢; reverse, 5¢-GGGCATGTGGTTCCTGTCC-3¢. Cdc20: forward, 5¢-GCAACAGGAGGAGGAACCAG-3¢; reverse, 5¢-CATCCACAGCACTCAGACAGG-3¢. ... Cdkn 1a: forward, 5¢-AAAGTGTGCCGTTGTCTC-3¢;reverse, 5¢-AAAGTTCCACCGTTCTCG-3¢. Accn5: for-ward, 5¢-GGTGACCATCCGCCAACTG-3¢; reverse, 5¢-CCGTAAGTGCTGTAGGTAATGAAG-3¢. Onecut1: forward,5¢-CCTCTATGAATAACCTCTATACC-3¢;...

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... increase the sig-nal to noise ratio. All of the spectra were corrected for the Raman signal and background by subtracting the spectrum of the buffer.ATPase activityRad51 (5 lm) or a Rad51 mutant ... 2F) of the puriﬁed Rad51-F27 9A were allsimilar to those of HsRad51, indicating that the muta-tion did not affect the global structure, the polymerformation, and the ATPase activity. The mutation ... (jm)nicked circular DNA (nc)ssDNAdsDNAjmnc A BFig. 4. The strand-exchange activities of the Rad51 mutants. (A) A schematic diagram of the strand-exchange assay. (B) The Rad51 concen-trations were...

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... under-lined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined),then a secondary ampliﬁcation with primers 5¢-CACCACCACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢(His-tag underlined) ... underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tagunderlined) and 5¢-GCGGCATGCTCATCCAAAGAAGCTTGGGTCG-3¢. The two ampliﬁed fragments were usedas a combined template for the ... PSI-G or tagged PSI-G into thylakoids. Shown areﬂuorograms of the fractions obtained fromimport of radioactive precursors intoisolated, intact pea chloroplasts. The lanescorrespond to: in...

Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot

... Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20,3–26.31 Taniguchi T, Ogasawara K, Takaoka A & Tanaka N(2001) IRF family of transcription factors as regulators of ... from )88 to )68)for phLP3; CGGGTACCTACTCAGGAAGCATGCAAGT (sense strand of the sequence from )67 to )47)for phLP4; CGGGTACCACAGAAAGTGAAAGCA(sense strand of the sequence from )33 to )18) forphLP5; ... luciferase assay system (Promega) accord-ing to the manufacturer’s instruction. Luciferase activitywas measured in triplicate, averaged, and then normalized to b-galactosidase activity to correct for...

Báo cáo khoa học: Internalization of the human CRF receptor 1 is independent of classical phosphorylation sites and of b-arrestin 1 recruitment potx

... used the CRFanalogue125I-labelled sauvagine for i nternalization studies. The use of radioligand internalization to assay receptorinternalization is based on the assumption that receptor andligand ... for a more profound translocation of b-arrestin1 to the receptor.Interestingly, removal of putative phosphorylation sites in the C-terminal tail and /or IC3 did not alter the extent of receptor ... thisreceptor. The effect of PKA and PKC was investigated by use of the speciﬁc PKA inhibitor H-89 and the broad-spectrumprotein kinase inhibitor stauroporine. Radioligand inter-nalization assay was performed...

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... lack of a sustainable financial policy,inadequate infrastructure, under-trained faculty membersin some areas, poor instructional materials and equip-ment and lack of a formal evaluation and ... mainly in the medicine specialty of the medicalsector (8.9%)Although QAAP is one of the six projects of the HEEP,8.9% of the medical sector projects of the HEEPFaddressed the area of quality ... solelyon the total score of the secondary school graduation cer-tificate. Applicants for medical sector colleges always have the highest marks among high school graduates, as thesecolleges admit...

Xem thêm

Từ khóa: đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI