Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate d...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx
... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 3 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... RESEARC H Open Access Insertion of the human sodium iodide symporter to faci...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... oli- gonucleotides: For the NL4-3 vpu TM region, NL-TM-F, CATGGAGATGCAACCTATAATAGTAGCAATAGTAG- CATT AGTAGTAGCAATAATAATAGCAATAGCTGTGT- GGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTAC- TATTATAGGTTGCATCTC; ... NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTAC- TATTATAGGTTGCATCTC; for the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt
... used for UL132: 5'-TACACCCT- GTCACCGAA AGC-3' (forward); 5'-CTGATCGCGG- TAGTTTACTC-3' (forward); and 5'-TCACGAACGAC GTGTCCAAG-3' (reverse). Northern analysis Northern ... used for the Portland specimens for the same region were 5'-GCTTAAGCCAATCGCAGCGAGC-3' and 5'-GTC GCCTCGGTAGCTCAGTAGC-3'. The amplification proto- cols were the same a...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf
... Sdc4: forward, 5¢-GCGGCTCGGATGACTTTG-3¢; reverse, 5¢- AAGGGCTCAATCACTTCAGG-3¢. Cib3: forward, 5¢- ATGACTTCAACAATGACAACTAC-3¢; reverse, 5¢-ATC CAGCACCTTCTCACAG-3¢. Cyp 4a1 0 ⁄ 31: forward, 5¢-GC CTCTGTGCTCGGTCTG-3¢; ... 5¢-AGCCTTGAGTA GCCATTGCC-3¢. Cyp2c39: forward 5¢-TGCTCTCCTAC TCCTGATGAAG-3¢; reverse, 5¢-GGGCATGTGGTTCCT GTCC-3¢. Cdc20: forward, 5¢-GCAACAGGAGGAGGA ACCAG-3¢; reverse, 5¢-CATCC...
Ngày tải lên: 23/03/2014, 06:20
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... increase the sig- nal to noise ratio. All of the spectra were corrected for the Raman signal and background by subtracting the spectrum of the buffer. ATPase activity Rad51 (5 lm) or a Rad51 mutant ... 2F) of the purified Rad51-F27 9A were all similar to those of HsRad51, indicating that the muta- tion did not affect the global structure, the polymer format...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) ... underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢. The two amplified fragments were used as...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot
... Compilation of vertebrate- encoded transcription factors. Nucleic Acids Res 20, 3–26. 31 Taniguchi T, Ogasawara K, Takaoka A & Tanaka N (2001) IRF family of transcription factors as regulators of ... from )88 to )68) for phLP3; CGGGTACCTACTCAGGAAGCATGC AAGT (sense strand of the sequence from )67 to )47) for phLP4; CGGGTACCACAGAAAGTGAAAGCA (sense strand of the sequence...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Internalization of the human CRF receptor 1 is independent of classical phosphorylation sites and of b-arrestin 1 recruitment potx
... used the CRF analogue 125 I-labelled sauvagine for i nternalization studies. The use of radioligand internalization to assay receptor internalization is based on the assumption that receptor and ligand ... for a more profound translocation of b-arrestin1 to the receptor. Interestingly, removal of putative phosphorylation sites in the C-terminal tail and /or IC3 did not...
Ngày tải lên: 30/03/2014, 15:20
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... lack of a sustainable financial policy, inadequate infrastructure, under-trained faculty members in some areas, poor instructional materials and equip- ment and lack of a formal evaluation and ... mainly in the medicine specialty of the medical sector (8.9%) Although QAAP is one of the six projects of the HEEP, 8.9% of the medical sector projects of the HEEPF add...
Ngày tải lên: 18/06/2014, 17:20