Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx
Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx
... YZ participated in nanoparticle characterization, DC imaging and data analysis. MO participated in nanoparticle characterization, DC loading and imaging and data analysis. MH participated in DC ... and loading, analysis of presentation of murine MHC class II- restricted peptides and murine non-classical MHC class I, Qa-1-restricted peptides encapsulated int...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" doc
... 2 of 10 RESEARC H Open Access Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy Wenxue ... TAA-derived peptides to human DC, and the development of nanopartic le s incorporating MHC class II and non-classical MHC class I, Qa...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc
... co-circulation of a wild type virus along with a variant harboring a premature stop codon at aa 42 of the core protein, and a variant exhibiting a deletion of 28 aas (aa 78–105) (Figure 3). A partial ... Domingo J Garzaro, Aff2 Email: dgarzaro@gmail.com Mar a C Duarte, Aff1 Email: mcarolad@hotmail.com Daisy M Garc a, Aff1 Email: mayilag@hotmail.com Milian C P...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học:" Increased vulnerability of rural children on antiretroviral therapy attending public health facilities in South Africa: a retrospective cohort study" docx
... were increased levels of unavailable baseline clinical and on-treatment CD4 cell and viral load results at rural facilities. Unavail- able baseline clinical and immunological values were also independently ... Africa. Improving clinical outcomes and increasing uptake of ART Paediatric treatment is still provided mainly at hospitals due to the availability of paediatricians and...
Ngày tải lên: 20/06/2014, 08:20
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf
... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... migrated as a single band, of 33 kDa apparent molecular mass, on SDS ⁄ PAGE (Fig. 4). Kinetic parameters of WT and mutant enzymes were measured as described in the Ma...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... chromatin-bound proteins (Fig. 3 and Table 2). In contrast, the amounts of total Fig. 4. Abundance of Mcm2 mRNA in HeLa and WI-38 cells. (A) Total mRNA was purified from HeLa and WI-38 cells, and ... deep invasion. To further characterize the expression of Mcm4, PCNA and Ki67 in cancer cells, a section that contains a boundary region of CIS (CIN3 of FIGO classifica...
Ngày tải lên: 20/02/2014, 23:20
báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc
... regulate teaching and clin- ical practice" (General medicine #3, private clinic). Income, quality of care and workforce planning were three areas for regulation identified: "The principal ... degree of collective action over quality and the maintenance of professional reputations. Further research into this issue in rural areas is needed to ascertain the geographical...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The College of Medicine in the Republic of Malawi: towards sustainable staff development" docx
... Malawian staff already in place and the number of postgraduate trainees joining the COM. The way forward Clearly it will take many years before well trained and experienced Malawians can compete for ... return and it was felt that the medical training received abroad was not appropriate for a doctor working in an African setting [2]. The curriculum at the COM was introduced...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf
... 2001, 10(4):254-265. 34. Charest CA: Analysis of a transcultural innovation: the social- isation of Filipino-graduate nurses into an acute health care organisation in the United States. In Graduate School Volume ... nursing workforce in sub- Saharan Africa. In Issue Paper no 7 Geneva , International Council of Nurses; 2005. 29. Kline D: Push and pull factors in internatio...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Postoperative outcome of caesarean sections and other major emergency obstetric surgery by clinical officers and medical officers in Malawi" docx
... of America: measures of the African brain drain. Human Resources for Health 2004, 2:17. 7. Fernando D, Jaya Tilleka A, Karunaratna V: Pregnancy-reducing maternal deaths and disability in Sri Lanka ... Abstract Background: Clinical officers perform much of major emergency surgery in Malawi, in the absence of medical officers. The aim of this study was to validate the adva...
Ngày tải lên: 18/06/2014, 17:20