báo cáo hóa học: "Validity and reliability of a new, short symptom rating scale in patients with persistent atrial fibrillation" pot
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1). Glycine, ... JC, Fujita T, Liang R, Ganapathy V & Lei- bach FH (1998) Identification of a potential substrate binding domain in the mammalian peptide transporters PEPT1 and PEPT2 using P...
Ngày tải lên: 07/03/2014, 05:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. ... tyrosinase was also inactivated completely within 20 min [40]. In general, mammalian and plant-derived tyrosinases are not very thermostable; even a short incubation at 70–...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx
... defined as a set of syntactic and semantic features shared by one or several morpho-syntactic elements. Roughly speaking, it contains the kind of information one expect to find in a standard ... INTRODUCTION It has been traditionally assumed by computational linguists and particularly by designers of large natural language processing systems such as machine translatio...
Ngày tải lên: 22/02/2014, 09:20
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlighting in ... and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A TATA box was identified...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR. The N terminus of ... to act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... provement in parsing accuracy. Sample mappings from the terminals and non- terminals of our grammar to those of the Lancaster tree- bank are provided in Table 5. For ease of understanding, we ... hand, and have thus experi- mented with only a small number of paramcterizations. Constrained training: The Inside-Outside algo- rithm is a special case of the general...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, ... Mare  chal, P., Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 TGATACG CATATGTCACCGGCTGGC ARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 ... CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAG ARA460 CGT GAATTCACC...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order to introduce an NcoI restriction site, an extra alanine codon (GCA) was introduced ... was transformed with pWUR78 and a single colony was used to inoculate 5 mL Luria–Bertani medium with kanamycin and spectino- mycin (both 50 lgÆml )1 ) and incub...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... application of JA. These experiments demonstrate that individual mem- bers of the jasmonate family are involved – at least in Arabidopsis – in different signalling pathways. An Arabidopsis(jar1)mutantwithadefectinthe jasmonate ... t hey are capable of mediating a response by regulating gene expression [6,7]. Analysis of Arabidopsis thaliana mutants impaired in either JA biosyn...
Ngày tải lên: 16/03/2014, 18:20