Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

... Access Research Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland John F Menton*, Karen Kearney and John G Morgan Address: ... hospitals. Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on...

Ngày tải lên: 18/06/2014, 18:20

... found that all positives belonged to the GII/4 variant of NoV. Conclusion: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method ... Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Development of a real-time RT-PCR and Reverse Li...

Ngày tải lên: 20/06/2014, 01:20

... 15 consists in a minimization of the path length, according to the Fermat Principle. Finally, an adaptive IMR has been developed based on the localization of reflection points. Results obtained in a ... results of literature in a straight arch- shaped tunnel. Then, comparisons with measurements at 5.8 GHz are performed in a curved rectangular tunnel. Finally,...

Ngày tải lên: 18/06/2014, 22:20

... approval and review processes, support for students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available ... penalties for plagiarism and collu- sion. 4. Quality assurance of approval and review processes Aim To maintain the academic quality of courses and ensure th...

Ngày tải lên: 18/06/2014, 17:20

... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... and Accreditation of Laboratory Animal Care International. Mouse adaptation The general approach to adapt MARV to mice was based on virus passage in scid (BALB/c background) mi...

Ngày tải lên: 18/06/2014, 18:20

... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. Discussion We have developed a TaqMan probe- based QPCR assay to quantitate the viral load of macaque rhadinoviruses belonging ... from the antisense strand. OSM-Mn CCTCGGGCTCAGGAACAAC GTC TACTGCATGGCCCAGCTGCTGGACAA CTCAGACATGA CTGAGCCCACGAAGGCC OSM-AGM A OSM-Human A C.G...

Ngày tải lên: 18/06/2014, 22:20

... design, data collection and interpretation. PG provided intellec- tual and theoretical input for the paper and interpretation of the findings. All authors were involved in revising the manuscript and ... working abroad etc [15]. Each line on the chart would have an event number and a start and end date. Additional information was requested for nursing jobs, whi...

Ngày tải lên: 18/06/2014, 17:20

... each technique on a four-point scale (not at all satis- Importance of ways of learning about health planning and managementFigure 1 Importance of ways of learning about health planning and management. 0.0 ... purpose of the inter- views was to gain insights into the application and impact of the training, enrich the findings from the questionnaire and clarify u...

Ngày tải lên: 18/06/2014, 17:20

... contributions TW, SC and IB jointly formulated the study design, obtained and analysed the data, interpreted the findings and wrote the article. All authors had access to all data in the study and had final responsibility ... Mercer and Pascal Zurn, World Health Organization; and Anita Davies and Danielle Grondin (formerly IOM), International Organization for Migr...

Ngày tải lên: 18/06/2014, 17:20

... low- income settings. A number of challenges remain, includ- ing the ability to maintain a large volunteer workforce and to build partnerships and collaborations with other organizations. Competing ... collaborate with educational and other institutions in resource-poor settings, and hope that through their use of Peoples-uni courses and/ or joint accreditation of the...

Ngày tải lên: 18/06/2014, 17:20