báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
... Kirkpatrick DL: Training and Performance Appraisal - Are they Related? Improving Employee Performance Through Appraisal and Coaching 2006. 65. Kuvaas B: Performance Appraisal Satisfaction and ... five- pointLikertscale(where1=stronglydisagreeand5= strongly agree). Figure 1 An exploration of the effects of performance appraisal in municipal health services. How go...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... The University of Sydney, Westmead, New South Wales, Australia and 4 Department of Medicine, University of Calgary, N.W. Calgary, Alberta, Canada Email: Haran Sivakumaran - haran.sivakumaran@qimr.edu.au; ... transactivation (the SF2 clone of one-exon tat). The values at the bases of the columns indicate the number of times that particular Tat amino acid sequence was...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx
... III and Daniel Marcu. 2006. Domain adap- tation for statistical classifiers. In Journal of Artifi- cial Intelligence Research. Hal Daum ´ e III. 2007. Frustratingly easy domain adap- tation. In ... Liang Huang, Yajuan L ¨ u, and Qun Liu. 2008. A cascaded linear model for joint chinese word segmentation and part -of- speech tagging. In Proceedings of the 46th Annual Meeting of t...
Ngày tải lên: 17/03/2014, 01:20
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... organ- izing, leading and controlling. Planning involves defining goals and mapping out ways to reach them; organizing entails arranging and coordinating human, material and information resources aimed ... that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval da...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot
... purposes) remain, further increasing turnover [9]. The implications of these findings are therefore alarming for the provision of health care in South Africa now and in the future, given that we are already ... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of pri- mary healthcare doctors as knowledge w...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt
... and advising data analysis as well as writing manuscript JH: making study plan and advising data analysis as well as writing manuscript All authors read and approved the final manuscript Acknowledgements The ... -80°C for the measure- ments of TNF -a and ICAM-1 assay and isolation of PMNs. The same volume of fluid was replaced in all animals after sampling. The superior lob...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... (5¢-to3¢) Mutant GSTU1 E117K-for: AAGACATGGACCACA AAGGGAGAAGAGCAGGAG E117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATC RKI GSTU2 P89R-for: TGGCTTCCCTCTGATC GCTACCAGAGAGCTCAA P89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC RKV GSTU1 ... TTGCTTCCCTCTGATC CCTACCAGAGAGCTCAA R89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC PEI PEI E117K-for: TTTGGAAAGTCCAGC ATTGAGGCTGAGTGCCCC E117K-rev: GCTGGACTTTCCAAATGTCTCATA PKI Functional ro...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Identification of functional domains in the formyl peptide receptor-like 1 for agonist-induced cell chemotaxis doc
... These results, in addition to the binding data obtained with 125 I-labeled W peptide, indicate that the chimeric recep- tors are indeed expressed on the surface of HEK293 cells and are capable of coupling ... amyloid A (SAA) [9], a fragment of the neutrophil antibacterial granule pro- tein cathelicidin LL37 [10], and a peptide derived from human prion protein [11]. The...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Essential roles of lipoyl domains in the activated function and control of pyruvate dehydrogenase kinases and phosphatase isoform 1 pot
... kinase is reached when < 10% of the lipoyl groups in the assembled complex are acetylated. Near-maximal stimulation of the kinase activity is attained with an NADH/NAD + ratio of 0.1 and acetyl-CoA/CoA ... domains in the activated function and control of pyruvate dehydrogenase kinases and phosphatase isoform 1 Thomas E. Roche, Yasuaki Hiromasa, Ali Turkan, Xiaoming Gong...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Identification of domains involved in the allosteric regulation of cytosolic Arabidopsis thaliana NADP-malic enzymes ppt
... ME2GFP- F(5¢-CACCATGGGAAGTACTCCGACTGAT-3¢) and ME2GFP-R (5¢-AGCCCTGTGTACAGAAACTACCGT-3¢) and ME3GFP-F (5¢-CACCATGGGCACCAATCAGACT CAG-3¢) and ME3GFP-R (5¢-AGTCCTGTCTACAGAA ACTTCCGT-3¢), respectively. The ... one catalytic and the other allo- steric, as in the case of NADP-ME3 (data not shown). The K r values obtained (Table 1) indicate that the malate allosteric site of ME2.3...
Ngày tải lên: 23/03/2014, 04:20