báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

... This qualitative study was undertaken to understand how practicing doctors and medical leaders in Ghana describe the key factors reducing recruitment and retention of health professionals into remote ... in areas where you are not fully trained.” (UW) Occasionally a young doctor in GA complained about the lack of hands-on practice in the teaching hospit...

Ngày tải lên: 18/06/2014, 17:20

11 707 0
báo cáo sinh học:" Public-private partnerships to build human capacity in low income countries: findings from the Pfizer program" docx

báo cáo sinh học:" Public-private partnerships to build human capacity in low income countries: findings from the Pfizer program" docx

... training to clinical and research personnel; strengthened laboratory, pharmacy, financial control, and human resource management systems; and helped expand Partner organization networks. Local ... Goals, issues of human and organizational capacity are becoming increasingly impor- tant [1]. Governmental and non-governmental organiza- tions alike are dealing with important capacit...

Ngày tải lên: 18/06/2014, 17:20

11 560 0
báo cáo sinh học:" Major surgery delegation to mid-level health practitioners in Mozambique: health professionals'''' perceptions" pdf

báo cáo sinh học:" Major surgery delegation to mid-level health practitioners in Mozambique: health professionals'''' perceptions" pdf

... purpose of this study on health profession- als' perceptions and the first of its kind, was to document the opinions and attitudes of various health professionals toward TCs, using approaches and ... Corresponding author Abstract Background: This study examines the opinions of health professionals about the capacity and performance of the 'técnico...

Ngày tải lên: 18/06/2014, 17:20

9 264 0
báo cáo sinh học:" Leveraging human capital to reduce maternal mortality in India: enhanced public health system or public-private partnership?" docx

báo cáo sinh học:" Leveraging human capital to reduce maternal mortality in India: enhanced public health system or public-private partnership?" docx

... health workers in remote areas [64]. While overall maternal mortality continues to decline in Tamil Nadu, there is a dearth of data on the impact of individual health system strengthening measures ... mortality rate (IMR) of 54 per 1000 births, almost on par with the all-India average of 58. In contrast, Kerala had an IMR of 14, Maharashtra 36, Tamil Nadu 37, West...

Ngày tải lên: 18/06/2014, 17:20

8 458 0
báo cáo sinh học:" From staff-mix to skill-mix and beyond: towards a systemic approach to health workforce management" ppt

báo cáo sinh học:" From staff-mix to skill-mix and beyond: towards a systemic approach to health workforce management" ppt

... constraints. International variations in the scope of practice of health care professionals suggest that groupings of skills into professions are often arbitrary and owe more to custom, traditions, ... guidelines protocols, and medications) and their appropriate utilisation. In this respect, a growing amount of evidence suggests that the automation of clinical, fin...

Ngày tải lên: 18/06/2014, 17:20

19 519 0
Báo cáo sinh học: " Intravenous ascorbic acid to prevent and treat cancer-associated sepsis?" pptx

Báo cáo sinh học: " Intravenous ascorbic acid to prevent and treat cancer-associated sepsis?" pptx

... M, Kanda S, Hayashi T, Saito Y, Kanetake H: Predictive values of acute phase reactants, basic fetoprotein, and immunosuppressive acidic protein for staging and survival in renal cell carcinoma. ... Duconge J, Miranda-Massari JR, Gonzalez MJ, Jackson JA, Warnock W, Riordan NH: Pharmacokinetics of vitamin C: insights into the oral and intravenous administration of ascorbate. P R...

Ngày tải lên: 18/06/2014, 19:20

13 412 0
Báo cáo sinh học: " Risk factors in the development of stem cell therapy" pdf

Báo cáo sinh học: " Risk factors in the development of stem cell therapy" pdf

... patterns (e.g. growth factors, cytokines, chemokines) Extrinsic factors Manufacturing and handling - Lack of donor history - Disease transmission - Starting and raw materials - Reactivation of ... but also the safety data already obtained with similar type of products. In addition extrinsic risk factors like manufacturing, handling, sto- rage- and clinical or treatme nt rel...

Ngày tải lên: 18/06/2014, 19:20

14 582 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... weaker due to the fact that two non-canonical G:U base pairs presented in the plus-sense RNA occur as non- pairing C /A bases in the minus-sense RNA. Interestingly, in Puumala hantavirus, a hairpin-like ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3&a...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx

báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx

... service, finance, and education, and the private sector all have a role to play. Progress in dealing with these factors depends on manag- ers who are able to lead and inspire teams at all levels of the ... for health and in the health of populations – improvements that will last – managers need to know how to lead and how to influence HR changes within and...

Ngày tải lên: 18/06/2014, 17:20

4 437 0
Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

... Hussain AR, Al-Rasheed M, Manogaran PS, Al-Hussein KA, Platanias LC, Al- Kuraya K, Uddin S: Curcumin induces apoptosis via inhibition of PI3’- kinase/AKT pathway in acute T cell leukemias. Apoptosis ... performed using a reverse transcriptase first strand cDNA synthesis kit (Takara, Japan). The sequences of the sense and anti- sense primers were: 5’ -CTGGTGGACAACATCGC-3’ (sense) an...

Ngày tải lên: 18/06/2014, 19:20

15 416 0
w