báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx

báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx

báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx

... Discussions within the United States of America began among federal policy makers, medical and specialty societies, and educators, leading to the American Academy of Pediatrics (AAP) establishing a multi-organizational ... survey of ‘inactive’ physicians in the United States of America: enticements to reentry Ethan A Jewett 1 , Sarah E Brotherton 2*...

Ngày tải lên: 18/06/2014, 17:20

10 552 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... fragment from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), ... Sugimoto T, Ueyama H, Hosoi H, Inazawa J, Kato T, Kemshead JT, Reynolds CP, Gown AM, Mine H & Sawada T (1991) Alpha-smooth-muscle actin and des- min expressions in human neuroblastoma c...

Ngày tải lên: 16/03/2014, 23:20

13 483 0
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... MEF2- binding site, 5¢-CTA (A ⁄ T) 4 TAG ⁄ A- 3¢, was located (Fig. 3A) . The introduction of mutations at this site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished PGF 2a -induced transcriptional activation (Fig. ... Kuwano Y, Kawahara T, Yamamoto H, Teshima- Kondo S, Tominaga K, Masuda K, Kishi K, Morita K & Rokutan K (2006) Interferon-gamma activates tran- scription of NAD...

Ngày tải lên: 30/03/2014, 03:20

9 452 0
Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

... Compositionality in the Semantics of Adjectives There is a vast amount of linguistic data on which a formal semantics of adjectives can be evaluated, such as the interaction of comparative and equative ... of this kind of reasoning are dependent on the types of relations that appear in the knowledge base. Thus in the present paper, I investigate the kin...

Ngày tải lên: 01/04/2014, 00:20

10 537 0
Báo cáo sinh học: " A SNR-based admission control scheme in WiFi-based vehicular networks" pot

Báo cáo sinh học: " A SNR-based admission control scheme in WiFi-based vehicular networks" pot

... at the value. By taking an integral of the area in Fig. 3 for given input rate q and time period I, the average number of vehicles during the time period I in the range of L i can be obtained as E[N] ... WiFi connectivity, and thus the handoff and car start times are not considered. Therefore, the throughput can be computed by dividing the total amount of data duri...

Ngày tải lên: 18/06/2014, 22:20

37 350 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"

Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"

... to maintain conformational stiffness and to retain water. One gram of HA can bind up to 6 L of water [6]. As a physical background material, it has functions in space filling, lubrication, ... necessary to the sub- sequent healing phases are generated such as growth factors and cytokines, which promote migration of in- flammatory cells, fibroblasts and endothelial ce...

Ngày tải lên: 03/11/2012, 11:35

7 770 0
Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt

Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt

... parse natural-language data adequately, the parsing system has to have not merely some fixed capability of being sensitive to a certain range of contexts but a capacity to increase its ... format. Rather, those alternatives that will really make a difference in the adequacy of the parsings of natural-language sentences will be alterations of the format it...

Ngày tải lên: 07/03/2014, 18:20

2 420 0
Báo cáo sinh học: "Improving energy efficiency through multimode transmission in the downlink MIMO systems" docx

Báo cáo sinh học: "Improving energy efficiency through multimode transmission in the downlink MIMO systems" docx

... general link adaptation strategy was proposed in [10] and the system parameters including the number of data streams, number of transmit/receive antennas, use of spatial multiplexing or space time ... plotted. The performance of capacity estimation and the optimal estimation are almost the same, which indicates that the capacity estimation of the SU-MIMO systems is r...

Ngày tải lên: 18/06/2014, 22:20

28 382 0
Báo cáo khoa học: A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases potx

Báo cáo khoa học: A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases potx

... grisea (EAA26709)N. crassa (EAA60949)E. nidulans (EAA62614)E. nidulans (EAA28688)N. crassa (EAA48428)M. grisea (EAA74986)G. zeae (EAA73155)G. zeae (EAA54742)M. grisea (EAA67655)G. zeae (EAA36073)N. ... containing Chi18-5 (Ech42) as well as the intracellular Chi18-7 in a ter- minal branch. The topology of the group A tree sug- gests that none of the H. jecorina chitinases are...

Ngày tải lên: 07/03/2014, 12:20

17 454 0
báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc

báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc

... caesarean sections was estimated at each facility by dividing the volume of caesar- ean-related laboratory exams and operations by total lab- oratory exams and total life-saving surgeries for mothers, respectively. The ... Institute of Statistics and Demography (INSD), and Macro International Inc: Demographic and Health Survey. Burkina Faso 2003 Calverton, Maryland (USA): Macro Inter...

Ngày tải lên: 18/06/2014, 17:20

12 359 0
w