báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx
báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx
... Discussions within the United States of America began among federal policymakers, medical and specialty societies, and educators,leading to the American Academy of Pediatrics (AAP)establishing a multi-organizational ... survey of ‘inactive’ physicians in the United States of America: enticements to reentryEthan A Jewett1, Sarah E Brotherton2*, Holly Ruch-Ross3AbstractBackground: Physicians leaving and reentering ... by a grant from the American Medical AssociationWomen Physicians Congress through the Joan F. Giambalvo MemorialScholarship, to aid in data acquisition, survey printing and mailing, andstatistical...
- 10
- 552
- 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... fragment from the humantrypsinogen prepro sequence was amplified from humanpancreatic cDNA using the primer set (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), ... Sugimoto T, Ueyama H, Hosoi H, Inazawa J, Kato T,Kemshead JT, Reynolds CP, Gown AM, Mine H &Sawada T (1991) Alpha-smooth-muscle actin and des-min expressions in human neuroblastoma cell lines. ... activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated times. Whiteand shadowed bars indicate before and after activation by enterokinase,...
- 13
- 483
- 0
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... MEF2-binding site, 5¢-CTA (A ⁄ T)4TAG ⁄ A- 3¢, was located(Fig. 3A) . The introduction of mutations at thissite (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢)abolished PGF 2a -induced transcriptional activation(Fig. ... Kuwano Y, Kawahara T, Yamamoto H, Teshima-Kondo S, Tominaga K, Masuda K, Kishi K, Morita K& Rokutan K (2006) Interferon-gamma activates tran-scription of NADPH oxidase 1 gene and upregulatesproduction ... Fujita T, Nagai R & Hirata Y (2002)Angiotensin II induces myocyte enhancer factor 2- andcalcineurin ⁄ nuclear factor of activated T cell-dependenttranscriptional activation in vascular myocytes....
- 9
- 452
- 0
Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx
... Compositionality in the Semantics of Adjectives There is a vast amount of linguistic data on which a formal semantics of adjectives can be evaluated, such as the interaction of comparative and equative ... of this kind of reasoning are dependent on the types of relations that appear in the knowledge base. Thus in the present paper, I investigate the kinds of relations that appear in formal theories ... than a knock-down argument against compositionality, since the increased com- plexity of the compositional approach may be manageable if certain assumptions about the application domain can...
- 10
- 537
- 0
Báo cáo sinh học: " A SNR-based admission control scheme in WiFi-based vehicular networks" pot
... at the value. By taking an integral of the area in Fig. 3 for given input rate qand time period I, the average number of vehicles during the time period I in the range of Lican beobtained asE[N] ... WiFiconnectivity, and thus the handoff and car start times are not considered. Therefore, the throughput canbe computed by dividing the total amount of data during travel with the total traveling time. A. ... avoidance-based WLANs, each node has the same opportu-nity to access the channel, and the channel utilization by a node can be defined as the ratio between the transmission time of the node and the total...
- 37
- 350
- 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"
... to maintain conformational stiffness and to retain water. One gram of HA can bind up to 6 L of water [6]. As a physical background material, it has functions in space filling, lubrication, ... necessary to the sub-sequent healing phases are generated such as growth factors and cytokines, which promote migration of in- flammatory cells, fibroblasts and endothelial cells into the damaged ... anaesthesia, intrasulcular incisions were made at the buccal and lingual sides with Bard-Parker surgical blade n° 15, at least one tooth away from the mesial portion, distally to the graft site, to...
- 7
- 769
- 0
Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt
... parse natural-language data adequately, the parsing system has to have not merely some fixed capability of being sensitive to a certain range of contexts but a capacity to increase its ... format. Rather, those alternatives that will really make a difference in the adequacy of the parsings of natural-language sentences will be alterations of the format itself in terms of in- ... parsing algorithm and to view the remaining portions as forms of input data. 5. Leaving aside the matters of rule format and input data, two further questions can be raised con- cerning the...
- 2
- 419
- 0
Báo cáo sinh học: "Improving energy efficiency through multimode transmission in the downlink MIMO systems" docx
... general link adaptation strategy was proposed in [10] and the system parametersincluding the number of data streams, number of transmit/receive antennas, use of spatial multiplexing or spacetime ... plotted. The performance of capacity estimation and the optimal estimation are almost the same, which indicates that the capacity estimation of the SU-MIMO systemsis robust to the delayed CSIT. Another ... number increases as the distance increases. The reason of the preferred mode variation canbe explained as follows. The total power can be divided into PC power, transmit antenna number related...
- 28
- 381
- 0
Báo cáo khoa học: A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases potx
... grisea(EAA26709)N. crassa(EAA60949)E. nidulans(EAA62614)E. nidulans(EAA28688)N. crassa(EAA48428)M. grisea(EAA74986)G. zeae(EAA73155)G. zeae(EAA54742)M. grisea(EAA67655)G. zeae(EAA36073)N. ... containing Chi18-5(Ech42) as well as the intracellular Chi18-7 in a ter-minal branch. The topology of the group A tree sug-gests that none of the H. jecorina chitinases are the products of ... (EAA61799)G. zeae (EAA77156)(EAA72565)G. zeae(EAA75711)G. zeae(EAA55685)M. grisea(EAA60172)E. nidulans(EAA66616)E. nidulans(EAA66640)E. nidulans(EAA50775)M. grisea(EAA78168)G. zeae(EAA74768)G....
- 17
- 454
- 0
báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc
... caesarean sections wasestimated at each facility by dividing the volume of caesar-ean-related laboratory exams and operations by total lab-oratory exams and total life-saving surgeries for mothers,respectively. The ... Institute of Statistics and Demography (INSD), and MacroInternational Inc: Demographic and Health Survey. Burkina Faso 2003Calverton, Maryland (USA): Macro International Inc; 2004. 13. Maternal mortality ... the annual training and deployment costs of providers. The annual training cost of an obstetricianwas estimated at 1.49 million CFA, or 8231 internationaldollars, 30% higher than the training...
- 12
- 359
- 0
Từ khóa: báo cáo sinh học haybáo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ