báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

... be able to operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMC and staff received training about the administration and maintenance of the upgraded ICT system. Developing ... article as: Spero et al .: Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda. Hu...

Ngày tải lên: 18/06/2014, 17:20

10 535 0
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx

báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx

... and retraining, including shifting as many tasks as possible away from doctors, nurses and pharmacists to non-clini- cal staff, enabling clinical staff to concentrate on their spe- cific areas ... growing rapidly and they need additional training, the team goes and assesses the needed training" [interview, national level, October 2007]. The training helps build capacity of...

Ngày tải lên: 18/06/2014, 17:20

9 595 0
báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

... Mozam- bique, Tanzania, Uganda and Zambia have such cadres who are doing essential medical tasks, especially in rural areas [8]. In Malawi, clinical officers are a major resource of the health sector; they ... in the literature review, study design, data collection and analysis. FM participated in the data collection, data cleaning and preliminary analysis. MM and DH...

Ngày tải lên: 18/06/2014, 17:20

9 455 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

... anatomicopathologic macroscopic and microscopic examinations and delivered clinical patients’ data. All authors read and accepted the final manuscript. Competing interests The authors declare that they have no ... 04688945001 TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat. No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (...

Ngày tải lên: 18/06/2014, 22:20

9 460 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

... data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, CS coordinated ... mandatory, in the OSNA assay amplification directly starts from the lysate and therefore allows analysis of 3-4 LN within 30-40 minutes and 12 LN within 2 hours. For the r...

Ngày tải lên: 18/06/2014, 16:20

6 535 0
báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

... an individual basis at each facility. In some cases, training information was not yet entered into TIMS, and the part- ners collected all training information about the providers and their HIV/AIDS ... found that using information gathered in a standardized way by PEPFAR partners dur- ing routine supervision visits and entered into the TIMS database demonstrates an inn...

Ngày tải lên: 18/06/2014, 17:20

8 364 0
báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf

báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf

... formulated the study design. MC obtained the data. MC and AA were involved in the con- ceptualization, initial drafts and final write-up of the paper. All authors had access to all data in the ... HR Management Module in the ArteRH database at the MHS-BH did not contain this information. Analysis of the data Two main categories were used for the analysis of the...

Ngày tải lên: 18/06/2014, 17:20

13 544 0
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot

báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot

... interests. Authors' contributions PM and NCK conceived and coordinated the study and drafted the paper; PM carried out the mathematical analysis; AT, DK, NS, NP and ET collected data and assisted in ... Mariolis A, Mihas C, Alevizos A, Papathanasiou M, Mariolis-Sapsakos T, Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in Primary Health Car...

Ngày tải lên: 18/06/2014, 17:20

11 380 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

... formal demonstration in a clinical trial using clinical grade virus preparations. Evaluation of the two vaccine candidates revealed that they are reasonable candidates for further study in clinical trials. ... performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical ana...

Ngày tải lên: 18/06/2014, 18:20

13 504 0
Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

... India99 AF390623 A India99 AF390659 A India2001 AF390630 A India99 AF390626 A India99 AF390638 A India99 AF390636 A India99 AF390672 A India93 AF390640 A India99 AF390637 A India99 AF390641 A India88 AF390608 ... 2006 O O A ASIA1 ASIA1 ASIA1, A, O A A22 O O Asia1, A, O A A Asia1, A 0.1 EF611987 Uganda 2006 AY593823 O1 Manisa AY687333 Asia1 India01 AY593799 Asi...

Ngày tải lên: 18/06/2014, 18:20

12 556 0
w