báo cáo sinh học:" Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital" pdf

báo cáo sinh học:" Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital" pdf

báo cáo sinh học:" Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital" pdf

... non-financial incentives and motivating factors were appreciation by managers, colleagues and the com- munity, a stable job and income and training. A study from Mali based on a mixed-methods approach ... article as: Lambrou et al.: Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital. Human Resources f...

Ngày tải lên: 18/06/2014, 17:20

9 542 1
Báo cáo sinh học: "Value of large scale expansion of tumor infiltrating lymphocytes in a compartmentalised gas-permeable bag: interests for adoptive immunotherapy" potx

Báo cáo sinh học: "Value of large scale expansion of tumor infiltrating lymphocytes in a compartmentalised gas-permeable bag: interests for adoptive immunotherapy" potx

... irradiated LAZ cells) are plated in sixty 96-well plates for stimulation. Ten days later, TIL are pooled and expanded in culture bags before being administered to patients (see “Materials and ... with identical TIL and feeder cell ratios and total cell con- centration to those u sed in the standard protocol with plates. Preliminary data indicate that by increa sing the cell conc...

Ngày tải lên: 18/06/2014, 19:20

9 397 0
báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx

báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx

... professional and technical cadres, coupled with a major initiative to recruit and re-engage qualified Malawian staff. • Expanding domestic training capacity, including dou- bling the number of nurses and ... hospital care in many rural areas. Medical assistants receive two years of training and mainly provide medical care in health centres and the outpatient departments...

Ngày tải lên: 18/06/2014, 17:20

13 586 0
báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

... Collaborative Health Alliance for Reshaping Training, Education and Research (CHARTER) grant awarded by the Bill and Melinda Gates Foundation (Grant number: 50786). Ghana-Michigan CHARTER is a collaborative ... in areas where you are not fully trained.” (UW) Occasionally a young doctor in GA complained about the lack of hands-on practice in the teaching hospitals, but mentoring...

Ngày tải lên: 18/06/2014, 17:20

11 707 0
Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

... India99 AF390623 A India99 AF390659 A India2001 AF390630 A India99 AF390626 A India99 AF390638 A India99 AF390636 A India99 AF390672 A India93 AF390640 A India99 AF390637 A India99 AF390641 A India88 AF390608 ... 2006 O O A ASIA1 ASIA1 ASIA1, A, O A A22 O O Asia1, A, O A A Asia1, A 0.1 EF611987 Uganda 2006 AY593823 O1 Manisa AY687333 Asia1 India01 AY593799 Asi...

Ngày tải lên: 18/06/2014, 18:20

12 556 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt

Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt

... assess tissue viability, thereby gain the staging and therapy monitoring by qualitative analysis of SUV and quantitative evaluation based on the compartmental analysis of kinetic parameters [2]. ... the application of radiolabeled somatostatin analogs in nuclear medicine for diagnostics and therapy of neuroendocrine tumors has achieved success and stimulated the research in r...

Ngày tải lên: 18/06/2014, 18:20

23 350 0
Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

... Hussain AR, Al-Rasheed M, Manogaran PS, Al-Hussein KA, Platanias LC, Al- Kuraya K, Uddin S: Curcumin induces apoptosis via inhibition of PI3’- kinase/AKT pathway in acute T cell leukemias. Apoptosis ... performed using a reverse transcriptase first strand cDNA synthesis kit (Takara, Japan). The sequences of the sense and anti- sense primers were: 5’ -CTGGTGGACAACATCGC-3’ (sense) and 5...

Ngày tải lên: 18/06/2014, 19:20

15 416 0
Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf

Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf

... total proteins and b-actin was used as a loading control. Phosphorylation was analyzed with antibodies against pRAF, pMEK, pERK, pLKB1, pAMPKa, pACC, pS6K, pS6, and their total proteins. a) BRAF V600E mutant ... experiments was performed in an LSR-II (BD Biosciences) and data was analyzed using FlowJo (Tree Star Inc, Asland, OR). Apoptosis analysis Cells were plated in 6-well pla...

Ngày tải lên: 18/06/2014, 19:20

13 518 0
Báo cáo sinh học: "Cytotoxic T lymphocyte responses against melanocytes and melanoma" pdf

Báo cáo sinh học: "Cytotoxic T lymphocyte responses against melanocytes and melanoma" pdf

... 5’-AGTTCTAGGGG GCCCAGTGTCT-3’, (AS): 5’-GGGCCAGGCTCCAGG- TAAGTAT-3’; MART-1 (Melan -A) (S):5’-TGACCCTA- CAAGATGCCAAGAG-3’, (AS): 5’-ATCATGCATTGCA ACATTTATTGATGGAG-3’. The real-time qRT-PCR was performed in single ... MeWo are HLA -A* 0201-positive and express MAAs gp100, MART-1, and tyrosinase. A3 75 is also a HLA -A* 0201-positive melanoma line but is defec- tive in intracellular...

Ngày tải lên: 18/06/2014, 22:20

10 312 0
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

... 2304 T2S59 GCGUGA UCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C12 GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C18 ... 2304 T1L GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUAC...

Ngày tải lên: 18/06/2014, 22:20

17 379 0
w