báo cáo sinh học:" Profile and professional expectations of medical students in Mozambique: a longitudinal study" doc

... Ferrinho P, Sidat M, Fresta MJ, Rodrigues A, Fronteira I, da Silva F, Mercer H, Cabral J, Dussault G: The training and professional expectations of medical students in Angola, Guinea-Bissau and ... Maputo Faculty, but also to other Moz ambican and African Faculties. The studies provide longitudinal data about medical training in A frica, more specifically in Mozam...

Ngày tải lên: 18/06/2014, 17:20

... Mariolis A, Mihas C, Alevizos A, Papathanasiou M, Mariolis-Sapsakos T, Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in Primary Health Care as a component of undergraduate ... and trained as indistinguishable members of each program's medical team. It is during the final 10 months that they are practically introduced to the challenges and esteem...

Ngày tải lên: 18/06/2014, 17:20

... 9:9 http://www.human-resources-health.com/content/9/1/9 Page 3 of 5 RESEARCH Open Access The training and professional expectations of medical students in Angola, Guinea-Bissau and Mozambique Paulo Ferrinho 1,2* , Mohsin Sidat 3 , Mário ... to describe and analyze the professional expec tations of medical students during the 2007-2008 academic year at the public m...

Ngày tải lên: 18/06/2014, 17:20

... USA and 2 Department of Pathology and Animal Health, Faculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, Jordan Email: Hadi M Yassine - yassine.2@osu.edu; Mohammad ... swabs from pigs and tracheal swabs from turkeys were collected on daily basis and were maintained in Brain Heart Infusion (BHI) media and were directly used for RNA extracti...

Ngày tải lên: 18/06/2014, 18:20

... not have any opinion. Regarding the quality of the training received, 52% felt it was adequate or very adequate, 20% that it was inade- quate or very inadequate and the remainder did not have any opinion. Expectations ... th year of medical education) on a specified day, during agreed lecture peri- ods, in April and May of 1999 (see Figure 2). All data were entered into an A...

Ngày tải lên: 18/06/2014, 17:20

... non-financial incentives and motivating factors were appreciation by managers, colleagues and the com- munity, a stable job and income and training. A study from Mali based on a mixed-methods approach ... Understanding and motivating health care employees: integrating Maslow’s hierarchy of needs, training and technology. J Nurs Manag 2003, 11:315-320. 17. Young EA: The me...

Ngày tải lên: 18/06/2014, 17:20

... Tax-2 transactivator function resulting in loss of viral replication Chiara Orlandi, Greta Forlani, Giovanna Tosi and Roberto S Accolla * Abstract Background: MHC class II transactivator CIITA ... the Caribbean basin. HTLV-2 infect ion is h ighly concen- trated in Cent ral and West Africa, in native Amerindian populations in North, Central, and South America, and among cohor...

Ngày tải lên: 18/06/2014, 22:20

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a ... formation with guanine and hypoxanthine bases, respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the purine base and...

Ngày tải lên: 15/02/2014, 01:20

... following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGA AACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGG GT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and ... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan...

Ngày tải lên: 18/02/2014, 16:20

... design Candidate Regions* Sequence ORF located in 8~26 ACCTCTGCCTAATCATCTC X/preC 40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC 591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein 993~1018 GGGTCACCATATTCTTGGGAACAAGA ... analysis. Extraction of serum HBV DNA Serum viral DNA was extracted by using commercially available kits (QIAamp DNA Blood Mini Kit, QIAGEN, Inc., Valencia, CA). Polymerase cha...

Ngày tải lên: 18/06/2014, 18:20