báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt
... 2006, 5:3. 32. Dehghan Nayeri N, Nazari A, Salsali M, Ahmadi F, Adib Hajbaghery M: Iranian staff nurses' views of their productivity and manage- ment factors improving and impeding it: a qualitative study. Nursing ... among Iranian hospital nurses: a qualitative study Nahid Dehghan Nayeri and Reza Negarandeh* Address: School of Nursing and Midwifery, Tehran University...
Ngày tải lên: 18/06/2014, 17:20
... health workers at hospitals and urban areas, to the disadvan- tage of health centers, clinics and rural areas. Table 3 shows the relative need of each health worker cadre by facility type. Nurse aides are ... Liberia, OFM Payroll Database. (Monrovia: Ministry of Health & Social Welfare, 2010) 12. MOHSW/CHAI, Workforce Optimization Model: Optimal Health Worker Allocation for Healthcare Fac...
Ngày tải lên: 18/06/2014, 17:20
... analysed by electrophoresis on a 2% agarose gel. The primer pairs used were ACMV DNA A F: CTCAACTAGAGACACTCTTGA and R: CACAAATATT- TAATTGCCAG, Tnt-retroposon (GenBank: X13777 ) F: CATTGGTTCTAAAGGATGTGCGGC ... [8]. The siRNA isolation and analysis was performed as described previously [2]. The DNA probe used for siRNA northern hybridization (AGGGGCCAACCGTATAATATTACCC) corresponds to the No...
Ngày tải lên: 19/06/2014, 08:20
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... that varia- ble. This allows one to treat the data as interval data measuring a latent variable, to which parametric statistical tests can be applied. Reliability of scales was estimated by assessing ... the management competency subscales are presented in Table 3 below. The Cronbach's alphas for all the scales are at an acceptable level of reliability, averaging 0.845. As a group,...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Does type of hospital ownership influence physicians'''' daily work schedules? An observational real-time study in German hospital departments" ppt
... Spearman's rank correlation coefficients. A p-value of less than .05 was identified as a significant result. Values were given as mean and standard deviations Table 1: Descriptive statistics ... of hospital department characteristics: comparison between hospital ownership types Variable Private, for-profit hospital department Public hospital department Private. non-profit ho...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Final call for papers: "Towards a scaling-up of training and education for health workers" potx
... that could be considered are: • What ongoing efforts to increase graduate level primary care training have been established in developing coun- tries. What has been their impact and what have ... socially accountable? • What is the status of existing collaborations between developing countries aiming to improve health worker education? • How have modifications in healthcare management had an...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot
... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of pri- mary healthcare doctors as knowledge workers, in the man- aged healthcare ... subscales Satisfaction All respondents Private sector Public sector Factors N of items Cronbach's alpha Mean N of items Cronbach's alpha Mean N of items Cronbach's alpha Mean Aut...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" International flow of Zambian nurses" ppt
... Hamada* - naomi.hamada@gmail.com; Jill Maben - jill.2.maben@kcl.ac.uk; Barbara McPake - bmcpake@qmu.ac.uk; Kara Hanson - kara.hanson@lshtm.ac.uk * Corresponding author Abstract This commentary ... Africa 3.Botswana 4.USA 5.New Zealand 6.Australia 7.Namibia 8.Swaziland Change of immigration policy in South Africa A ctive international recruitment policy in the UK Reduction of demand...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Monitoring the newly qualified nurses in Sweden: the Longitudinal Analysis of Nursing Education (LANE) study" ppt
... study participants updated and always included details of how to contact the research team. The research team was available to answer ques- tions and concerns by phone and e-mail. Data All data in ... graduates that had held a nursing position at some point since graduation, as well as the fact that the main reason for not working one year after graduation was maternity leave, was in accord...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Understanding the ‘four directions of travel’: qualitative research into the factors affecting recruitment and retention of doctors in rural Vietnam" doc
... hard to obtain a place, as places are limited and the pass mark very high. This means that bonding policies are less effect ive, according to national KI, as it is easy to repay the fees and avoid ... rural Vietnam Sophie Witter 1* , Bui Thi Thu Ha 2 , Bakhuti Shengalia 3 and Marko Vujicic 3 Abstract Background: Motivation and retention of health workers, particularly in rural areas, is a...
Ngày tải lên: 18/06/2014, 17:20