báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

... managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/ AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program. ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Cl...

Ngày tải lên: 18/06/2014, 17:20

... a standard proce- dure as indicated in Materials and method. (D) Summary of proteolysis. The putative domains of CI and its amino acid residues involved in formation of hinge, NTD and CTD are ... palas2004@gmail.com; Malabika Das - malavika_das@rediffmail.com; Nitai C Mandal - mandalnc2003@yahoo.com; Subrata Sau* - sau@bic.boseinst.ernet .in * Corresponding author Abs...

Ngày tải lên: 18/06/2014, 18:20

... myristoylation of the Gag N-terminal region and subsequent targeting of the protein to the plasma membrane. The interaction domain (I-domain) appears to be a major region involved in Gag multimerization. The ... multimerization. The late assembly domain (L-domain) plays a critical role in pinching off of virus particles from the plasma mem- brane of infected ce...

Ngày tải lên: 18/06/2014, 18:20

... in critical analysis of results. QL participated in conception and design, analysis and interpretation of data, and critical revision of the manuscript. All authors read and approved the final ... 14:719-29. 14. Mazumdar A, Henderson YC, El-Naggar AK, Sen S, Clayman GL: Aurora kinase A inhibition and paclitaxel as targeted combination therapy for head and neck squ...

Ngày tải lên: 18/06/2014, 19:20

... carried out and participated in the biological tests. M-Y A carried out and participated in the biological tests. B O carried out and participated in the biological tests. E M participated in ... pro- gram. Only P < 0.05 was considered significant. Authors' contributions D M coordinated and participated in the design of the study, statistical analysis...

Ngày tải lên: 18/06/2014, 22:20

... members: PAR-1, PAR-2, PAR-3 and PAR4. The co agulant protease throm bin is the physiolo- gical activator of PAR-1, PAR-3, and PAR-4. PAR-2 is activated by multiple trypsin-like serine proteases including ... Sato D, Yanaka A, Shibahara T, Matsui H, Nakahara A, Yanagawa T, Warabi E, Ishii T, Hyodo I: Peroxiredoxin I protects gastric mucosa from oxidative injury induced by H. pylor...

Ngày tải lên: 18/06/2014, 16:20

... NCR rhMPV/'M2-2/GFPpolyA: C ATTTAAAT TAGTAAAAACACATCAGAGTGGGATAAATGACAatg Swa I SH start codon M2/SH NCR deletion in M2-2 CGAAAAAATTA 11 nt Poly A insert GCTAGCTTAAAAAAGTGGGACAAGTCAAA atg GTG ... ATTTAAAT TAGTAAAAACACATCAGAGT GGG ATAAATGACAatg deletion in M2-2 M2-2 stop codon and SwaI D reading frame of GFP: ATG GTG AGC (in frame) reading frame of GFPpolyA: ATG GTG CGA AAA...

Ngày tải lên: 20/06/2014, 01:20

... arrival of migratory birds from Africa, Europe and the Middle East and also being the warmest time of the year when mosqui- toes would be relatively active and therefore capable of transmitting ... 10 days old, the proportion of maternally derived neutralization positive sera against the two strains of WNV and against USUV had dropped to 2/20, 0/20 and 2/20 respe...

Ngày tải lên: 20/06/2014, 01:20

... approval and review processes, support for students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available ... for plagiarism and collu- sion. 4. Quality assurance of approval and review processes Aim To maintain the academic quality of courses and ensure that courses rem...

Ngày tải lên: 18/06/2014, 17:20

... areas rural that are not in the vicinity of a city having a medical university and/ or hav- ing a high level health care institution. This paper concentrates on potential effects of training on the ... has graduated from medical school and is spending the first two years of postgraduate training in specialisation. These positions are centrally financed and offered...

Ngày tải lên: 18/06/2014, 17:20