báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

... These include planning, organ- izing, leading and controlling. Planning involves defining goals and mapping out ways to reach them; organizing entails arranging and coordinating human, material and information ... a survey of hospital manag- ers in the public and private sectors in South Africa, using a self administered questionnaire. The survey was con- d...

Ngày tải lên: 18/06/2014, 17:20

7 503 0
báo cáo sinh học:" Health workforce responses to global health initiatives funding: a comparison of Malawi and Zambia" docx

báo cáo sinh học:" Health workforce responses to global health initiatives funding: a comparison of Malawi and Zambia" docx

... and central hospitals. Facility managers reported that workload, which had been a long-standing and worsening problem in Malawi, was being tackled in several ways, including: training and rot ating additional ... with the national collation of PMTCT data, which was the responsibility of a separate section of the Ministry of Health to that collating ART data. In...

Ngày tải lên: 18/06/2014, 17:20

13 423 0
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

... purposes) remain, further increasing turnover [9]. The implications of these findings are therefore alarming for the provision of health care in South Africa now and in the future, given that we are already ... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of pri- mary healthcare doctors as kno...

Ngày tải lên: 18/06/2014, 17:20

10 515 1
báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx

báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx

... developing the training. AVR conceived of the study, participated in developing the training, coordinated the study with FB and helped to draft the manuscript. All authors read and approved the final ... consisting of a partici- pant's manual, a trainer's manual, Power Point ® slides, a training evaluation questionnaire and the revised treat- ment ca...

Ngày tải lên: 18/06/2014, 17:20

9 650 0
báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt

báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt

... effectively. Limitations The main disadvantage of the qualitative approach is that the findings cannot be replicated for a larger population with the same degree of certainty that quantitative analy- ses ... individual and cultural characteristics of the patient population and their family members were another work- place issue in various teaching hospitals. Because te...

Ngày tải lên: 18/06/2014, 17:20

8 354 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt

báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt

... – including migrant nurses from a range of countries; varying in age, marital status and dura- tion of working in Ireland; active and passive recruits; and those working in both the public and ... an understanding of meaning in complex data through the development of summary themes or categories from the raw data" [26]. Data management was facilitated by...

Ngày tải lên: 18/06/2014, 17:20

12 495 0
Báo cáo sinh học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial ce" pptx

Báo cáo sinh học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial ce" pptx

... p38 mitogen activated protein kinase (p38), nuclear factor of activated T cells (NFAT), c-Jun N-terminal kinase/stress- activated protein kinase (JNK/SAPK), and protein kinase C/activator protein-1 ... Relative quantitation was determined using the comparative C T method with data normalized to 36B4 mRNA and calibrated to the average ΔC T of untreated con- trols. Statistical anal...

Ngày tải lên: 18/06/2014, 18:20

9 458 0
Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx

Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx

... spinal cord. The primary sequelae are clinical manifestations of dysarthria, dyscoordination of limbs, instability of gait, and eventual loss of posture [1-3]. Spinocerebellar ataxia (SCA) and ... analyzed and interpreted data and helped to draft the manuscript. XH conceived of the study, participated in its design and coordination and helped to draft the manus...

Ngày tải lên: 18/06/2014, 19:20

5 324 0
Báo cáo sinh học: " Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" ppt

Báo cáo sinh học: " Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" ppt

... onset of WNV RNA Table 1: Small interfering RNA Name Virus Start Nucleotide Target Sequence Cap WNV Lineage I 312 gaacaaacaaacagcgatgaa Cap-Mut WNV Lineage I 312 gaagaaagaaagaccgatgaa M2 Influenza ... 8898 cagcaatgcagctttgggt 9095 WNV Lineage I 9095 gaagcagagccatttggtt 9607 WNV Lineage I 9607 gggaaaggacccaaagtca 10355 WNV Lineage I 10355 gagagatatgaagacacaac siRNA were generated against 19–...

Ngày tải lên: 19/06/2014, 08:20

13 340 0
Báo cáo sinh học: " Research Article One-Dimensional Compressible Viscous Micropolar Fluid Model: Stabilization of the Solution for the Cauchy Problem" pot

Báo cáo sinh học: " Research Article One-Dimensional Compressible Viscous Micropolar Fluid Model: Stabilization of the Solution for the Cauchy Problem" pot

... dτ, 3.24 Boundary Value Problems 5 In the proof of Theorem 2.1, we apply some ideas of 4 and obtain the similar results as in 5 where a stabilisation of the generalized solution was proved for the classical ... in Mathematics and Its Applications, North-Holland, Amsterdam, The Netherlands, 1990. 4 Ja. I. Kanel’, The Cauchy problem for equations of gas dy...

Ngày tải lên: 21/06/2014, 16:20

21 231 0
w