... for Health Open Access Research Nurses' experiences of recruitment and migration from developing countries: a phenomenological approach Paul H Troy 1 , Laura A Wyness 2 and Eilish McAuliffe* 3 Address: ... British Journal of Nursing 2001, 10(4):254-265. 34. Charest CA: Analysis of a transcultural innovation: the social- isation of Filipino-graduate nurses...
Ngày tải lên: 18/06/2014, 17:20
... countries in Africa), and others were from Egypt (2), India, Pakistan and Saudi Arabia. A study in Kenya identified inadequate national guide- lines as a cause of insufficient knowledge and practice: "The ... from lack of knowledge and practical skills; and (2) major areas of public health and clinical practice: maternal and child health (MCH), HIV/AIDS, sexua...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The health worker recruitment and deployment process in Kenya: an emergency hiring program" doc
... build leadership and management capacity at all levels; ▪ professionalizing HR departments and units and ensur- ing that HR staff have input into strategic decisions and HR innovations that will ... local labour market and patients with AIDS- related diseases can usually be discharged once they are started on ART and have been stabilized. The initial phases of the Emergency Hiri...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx
... CTCTGTCACCTGCATGGCCTGGTCT CCR3 ACCAGCTGTGAGCAGAGTAAACAT CACAGCAGTGGGTGTAGGCA CACCTCAGTCACCTGCATGGCCA CCR5 ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCA CCR6 TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT ... GCATCCTGGCAGCAAAGTTACGGG CXCR4 CTCCAAGGGCCACCAGAA GGCAAAGAAAGCTAGGATGAGG CGCAAGGCCCTCAAGACGACAGTC Chemokine MIP-1α TCATCGTTGACTATTTTGAAACCAG GCCGGTTTCTCTTAGTCAGGAA...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo khoa học: Structural characterization of L-glutamate oxidase from Streptomyces sp. X-119-6 pdf
... of FAD) of LGOX was found to be narrower than that of LAAO. A structural study of PAO also revealed a U-shaped funnel, which is more complicated than that of LAAO [21]. The LGOX funnel shape and ... perox- ide via an imino acid intermediate, LGOX catalyzes the oxidative deamination of the a- amino group of l-glutamate to 2-ketoglutarate, A simple photometric l-glutamate...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: NMR study of cellulose and wheat straw degradation by Ruminococcus albus 20 pdf
... O3 of xylose unit; Arap, arabinopyranose; CB, cellobiose; CD, cellodextrin; aGalf Man , a- galactofuranose in galactomannan or arabinogalactan; Glc, glucose; GlcA, glucuronic acid; GlcA Xyl , a- glucuronic ... analysed by 1 H NMR (Bruker Avance DSX at 500 MHz). Peak areas were integrated and the metabolite concentration was calculated relative to TSP-d 4 . Lactate, acetate and format...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Molecular characterization of artemin and ferritin from Artemia franciscana pot
... site (AAGATGG) and the poly (A) tail are shaded grey. The polyadenylation signals, AATAAA, are in bold and boxed, the ATTTA sequence and its variant ATTTTA are in bold and italicized, and a G/T ... 145 Molecular characterization of artemin and ferritin from Artemia franciscana Tao Chen 1, *, Reinout Amons 2 , James S. Clegg 3 , Alden H. Warner 4 and Thomas H. MacRae 1 1 D...
Ngày tải lên: 23/03/2014, 20:22
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot
... Adams A, Bond S: Hospital nurses' job satisfaction, individual and organizational characteristics. Journal of Advanced Nursing 2000, 32(3):536-543. 41. Kaplan RA, Boshoff AB, Kellerman AM: ... South Africa using a pretested and self-administered questionnaire. Univariate and bivariate statistical models were used to evaluate levels of satisfaction with various facets of wo...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
... and 5 World Health Organization Country Office, Lusaka, Zambia Email: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int; ... Nkowane* 1 , Liliane Boualam 2 , Salah Haithami 3 , El Tayeb Ahmed El Sayed 4 and Helen Mutambo 5 Address: 1 Department of Human Resources for Health, World Health Organization, Ge...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" International flow of Zambian nurses" ppt
... Africa 3.Botswana 4.USA 5.New Zealand 6.Australia 7.Namibia 8.Swaziland Change of immigration policy in South Africa A ctive international recruitment policy in the UK Reduction of demand ... Hamada* - naomi.hamada@gmail.com; Jill Maben - jill.2.maben@kcl.ac.uk; Barbara McPake - bmcpake@qmu.ac.uk; Kara Hanson - kara.hanson@lshtm.ac.uk * Corresponding author Abstract This commen...
Ngày tải lên: 18/06/2014, 17:20