Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

... this article as: Murphy et al., Transcriptional responses in the adapta- tion to ischaemia-reperfusion injury: a study of the effect of ischaemic pre- conditioning in total knee arthroplasty patients ... 5'-AGCCCTACGAGCACCTGAC-3' R: 5'-AGCGGCCAGTATAGGTGATG-3' PDK4 F: 5'-GTCCCTACAATGGCACAAGG-3' R: 5'-GGTTCATCAGCATCCGAGTAG-3...

Ngày tải lên: 18/06/2014, 16:20

11 617 0
Báo cáo hóa học: " Fowlpox virus recombinants expressing HPV-16 E6 and E7 oncogenes for the therapy of cervical carcinoma elicit humoral and cell-mediated responses in rabbits" pot

Báo cáo hóa học: " Fowlpox virus recombinants expressing HPV-16 E6 and E7 oncogenes for the therapy of cervical carcinoma elicit humoral and cell-mediated responses in rabbits" pot

... p53 and p105Rb, leading to transfor- mation and carcinogenesis [2], facilitate cell immortalisa- tion in primary human keratinocytes [3], increase genomic instability [4], and maintain the transformed phenotype ... Department of Medical Pharmacology, Università di Milano, Milan, Italy Full list of author information is available at the end of the article Radaelli et al. Journa...

Ngày tải lên: 18/06/2014, 16:20

12 456 0
Báo cáo khoa học: Transcriptional responses to glucose at different glycolytic rates in Saccharomyces cerevisiae ppt

Báo cáo khoa học: Transcriptional responses to glucose at different glycolytic rates in Saccharomyces cerevisiae ppt

... the respiratory metabolism of these strains. Discussion In this study we have used yeast strains with a very broad range of glycolytic rates to study glucose-induced responses while maintaining ... post-translational modifications [1–4]. A range of d ifferent signalling p athways, including, among others, the Snf1–Mig1 pathway, the Snf3–Rgt2 pathway and the Ras-cAMP...

Ngày tải lên: 16/03/2014, 18:20

10 309 0
báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

... and multiple factors are involved in the development of gastric cancer (GC). Among these factors, chronic inflammation is important particularly in the intestinal type of GC. The Correa hypothesis ... postulates that a progression from chronic gastritis to gastric atrophy, intestinal metaplasia (IM), dysplasia, and finally to cancer ('gastritis-dysplasia-carcinoma&apo...

Ngày tải lên: 18/06/2014, 15:20

11 536 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

... assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing. All authors read and approved the final manuscript. Additional ... one in the first- half period of hypobaric chamber stay (90 min) and the other in the second 90-min period of stay. The protocol of OME was the same as HME and also took plac...

Ngày tải lên: 18/06/2014, 15:20

6 427 0
báo cáo hóa học: "Using non-invasive brain stimulation to augment motor training-induced plasticity" doc

báo cáo hóa học: "Using non-invasive brain stimulation to augment motor training-induced plasticity" doc

... noninvasive brain stimulation appears to be an interesting option as an add-on intervention to standard physical therapies. Two non-invasive methods of inducing electrical currents into the brain ... citation purposes) Mechanisms of action of motor training in inducing plastic changes After brain damage, there is substantial recovery with clearly delineated dynamics, resulting...

Ngày tải lên: 19/06/2014, 08:20

13 453 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

... were produced in the parental strain (Fig. 2). The DdesA mutant was able to grow on Streptomy- ces minimal medium containing l-lysine as the only carbon and nitrogen source, indicating that the desA gene ... was of interest to perform a transcriptional analysis of this cluster and also to characterize the promoter region (transcription start point and regulatory sequ...

Ngày tải lên: 16/03/2014, 11:20

13 456 0
báo cáo hóa học:" The least core in fixed-income taxation models: a brief mathematical inspection" doc

báo cáo hóa học:" The least core in fixed-income taxation models: a brief mathematical inspection" doc

... of the points A or C, and the values of the distance at the points A, C are greater than the values of the distance at the points E, H, I, we get the desired strict inequality and this part of ... C() 7 The framework of piecewise linear taxations was used in the literature to analyze questions regard- ing the preponderant marginal-rate progressive taxat...

Ngày tải lên: 18/06/2014, 15:20

24 618 0
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx

báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx

... reverse-5'- GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5'- TCGTTCCCAATCCCAAGGTA-3'. The rat ... FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaq...

Ngày tải lên: 18/06/2014, 15:20

15 624 0
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

... interests. Authors' contributions JZY made contributions to the study design, acquisition of data, analysis and interpretation of data, and the writing of this manuscript. MAW participated in the analysis ... met- astatic and primary patients. In fact, IGFBP-3 sera levels of the majority of the melanoma patients fell within the nor- mal expected range for ad...

Ngày tải lên: 18/06/2014, 15:20

9 486 0
w