Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta ... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcct...

Ngày tải lên: 18/06/2014, 16:20

... replicated virus. In the future, quanti- tative real- time PCR can be employed to study in vitro effi- cacy of several potential therapeutic agents against JCV as well as to quantitate JCV trafficking ... gene [JCT-1 (For- ward: 5' AGA GTG TTG GGA TCC TGT GTT TT 3'; JCT-2 (Reverse) 5' GAG AAG TGG GAT GAA GAC CTG TTT 3'] (GeneBank Accession No. J02226) [15] in a...

Ngày tải lên: 19/06/2014, 08:20

... cytotoxicity. CD4 + T cell line cytotoxicity was evaluated in the presence of CMA and EGTA that block perforin-based pathway, and BFA and anti-FasL mAb that interfere with Fas/FasL-based pathway. ... 33081 Aviano, Italy. Authors’ contributions AM analyzed and interpreted data and wrote the manuscript. RT performe d flow cytometry analysis and wrote the manuscript. CT carried out experimen...

Ngày tải lên: 18/06/2014, 16:20

... testing was completed by a research physical ther- apist. KineAssist Gait and Balance Training System The KineAssist Gait and Balance Training System™ con- sists of a custom designed torso and pelvis ... KineAssist. Data Analysis The speed for each trial was computed using the distance of 10 m divided by the recorded time to complete that distance. Average step length was calculat...

Ngày tải lên: 19/06/2014, 08:20

...

Ngày tải lên: 11/03/2014, 08:20

... gender- discriminative words are clearly not the most rele- vant nor the most irrelevant features for topic clas- sification. They are slightly more topic-relevant features than topic-irrelevant but not by a ... on the distinctiveness of gender categories. The second approach is to apply feature selection methods, similar to those used in text cate- gorization, to reveal the most cha...

Ngày tải lên: 31/03/2014, 03:20

... automatically extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method. We apply statistical ... ward, and always at least plausible. The analysis of the linguistic tests and their com- binations has also led to a computational method for the determination of semantic m...

Ngày tải lên: 31/03/2014, 06:20

... show that 17AAG is an effective inhibitor of orthotopic tumor growth and that the response to treatment can be measured in real- time by ultrasound. We anticipate that this orthotopic model with high-resolution ... culture, have the capacity to be highly metastatic. This indicates that some aspect of GBM malig- nancy also satisfies the requirements for the metastatic process, or that...

Ngày tải lên: 18/06/2014, 15:20

... strategies and we advocate that a biostatistician/computational biologist should play a significant role in the committee. Moreover, the separation between training and validation phases is critical ... as multi-cellular organ- isms, are structured according to a hierarchy of genetic interactions that go from genomic DNA, to transcription into RNA and translation into functional uni...

Ngày tải lên: 18/06/2014, 15:20

... NK cells was detectable in the metastatic tissue which was taken after the cell- based therapy, whereas perforin was absent (Table 4). This might be related to the fact that TKD/IL-2 activated ... tumor (LVRT) 11 months after the start of the adoptive transfer of TKD/IL-2-activated effector cells and 13 months after the resection of the anastomotic relapse. At this stage a systemic chem...

Ngày tải lên: 18/06/2014, 15:20