differentiation of brewing yeast strains by pyrolysis

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

... the adenylylation of these compounds and the absence of synthesis of poly(A) by the E.colipoly(A) polymerase, we did not observed adenyly- lation of guanosine, GDP or Gp 4 G by the yeast enzyme. In ... independent synthesis of poly(A) In order to understand why dinucleoside polyphosphates activated the primer independent synthesis of poly(A),...
Ngày tải lên : 21/02/2014, 01:21
  • 7
  • 475
  • 0
Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

... 2007 FEBS 5895 Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) Juliana H. C. Smetana and Nilson I. ... Parallel purification of three catalytic subunits of the protein serine ⁄ threonine phos- phatase 2A family (PP2A(C), PP4(C), and PP6(C)) an...
Ngày tải lên : 07/03/2014, 05:20
  • 14
  • 419
  • 0
Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc

Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc

... reconstructed attractor is very similar to that of the directly observed metabolic attractor (Fig. 5). M. R. Roussel and D. Lloyd A chaotic multioscillatory metabolic attractor FEBS Journal 274 (2007) ... treat each variable as a separ- ate time series due to the lack of suitable methods for analyzing the dynamical properties of multidimen- sional data sets. We would e...
Ngày tải lên : 07/03/2014, 10:20
  • 8
  • 242
  • 0
Báo cáo khoa học: A large complex mediated by Moc1, Moc2 and Cpc2 regulates sexual differentiation in fission yeast ppt

Báo cáo khoa học: A large complex mediated by Moc1, Moc2 and Cpc2 regulates sexual differentiation in fission yeast ppt

... CGATTACGCCTCTGTGATTC Moc2 tagging primers Moc2- W CGTGGTTTAGATATTCCC Moc2- X GGGGATCCGTCGACCTGCAGCGTACGA CCACCA GGATTGAGCAC Moc2- Y GTTTAAACGAGCTCGAATTCATCGATGGGTTAC GTGCATCTGTG Moc2- Z CATGAGCTCAAAGCCTG Moc3 ... GCCGTGGTCGGTTCCG Moc4 tagging primers Moc4-W CCTAAGCTGTGCGTTCAATC Moc4-X GGGGATCCGTCGACCTGCAGCGTACGAAGGAGA TTGCTTAATAGTTGCAC Moc4-Y GTTTAAACGAGCTCGAATTCATCGATGTTGTTAT GCAATCTGG...
Ngày tải lên : 23/03/2014, 05:22
  • 18
  • 383
  • 0
Báo cáo khoa học: Functional transitions of F0F1-ATPase mediated by the inhibitory peptide IF1 in yeast coupled submitochondrial particles pdf

Báo cáo khoa học: Functional transitions of F0F1-ATPase mediated by the inhibitory peptide IF1 in yeast coupled submitochondrial particles pdf

... investi- gated in submitochondrial particles by studying the IF1- mediated ATPase inhibition in the presence and absence of a protonmotive force. In the presence of protonmotive force, IF1 added during ... shown in Fig. 3B. Curve 3 (dashed) was obtained by mul- tiplying ordinates of curve 1 by the ratio between uncoupled and coupled GTPase rates in th...
Ngày tải lên : 23/03/2014, 12:20
  • 8
  • 293
  • 0
Báo cáo Y học: Interaction between p21-activated protein kinase and Rac during differentiation of HL-60 human promyelocytic leukemia cell induced by all-trans-retinoic acid pdf

Báo cáo Y học: Interaction between p21-activated protein kinase and Rac during differentiation of HL-60 human promyelocytic leukemia cell induced by all-trans-retinoic acid pdf

... generating activity of HL-60 Cells Utilizing the induced differentiation of HL-60 promyelo- cytic leukemia cells as a model of myeloid maturation, we examined the expression and location of Rac and PAK. The interaction ... differenti- ation of HL-60 cells induced with ATRA. Induction of Rac and PAK HL-60 cells were treated with 1 l M ATRA for a week, an...
Ngày tải lên : 31/03/2014, 15:20
  • 8
  • 419
  • 0
differentiation of brewing yeast strains by pyrolysis

differentiation of brewing yeast strains by pyrolysis

... (1996). Analysis of production brewing strains of yeast by DNA fingerprinting. Lett. Appl. Microbiol. 22, 90–94. Windig, W., Haverkamp, J. and Kistemaker, P. G. (1983). Interpretation of sets of pyrolysis ... the cause of cross-contamination of pitching yeast by other production yeast strains. Also, work has shown that brewing yeasts may undergo genetic changes w...
Ngày tải lên : 12/06/2014, 11:18
  • 9
  • 181
  • 0
Báo cáo hóa học: " Effects of rehydration nutrients on H2S metabolism and formation of volatile sulfur compounds by the wine yeast VL3" docx

Báo cáo hóa học: " Effects of rehydration nutrients on H2S metabolism and formation of volatile sulfur compounds by the wine yeast VL3" docx

... 1:36 http://www.amb-express.com/content/1/1/36 Page 10 of 11 ORIGINAL Open Access Effects of rehydration nutrients on H 2 S metabolism and formation of volatile sulfur compounds by the wine yeast VL3 Gal Winter 1,2 , ... concentration of higher alcohols was decreased (Additional file 1). Further characterisation of the effect of rehydration nutrien...
Ngày tải lên : 20/06/2014, 23:20
  • 11
  • 505
  • 0
Báo cáo hóa học: " Formation of tungsten oxide nanostructures by laser pyrolysis: stars, fibres and spheres" ppt

Báo cáo hóa học: " Formation of tungsten oxide nanostructures by laser pyrolysis: stars, fibres and spheres" ppt

... 6:166 http://www.nanoscalereslett.com/content/6/1/166 Page 5 of 8 NANO EXPRESS Open Access Formation of tungsten oxide nanostructures by laser pyrolysis: stars, fibres and spheres Malcolm Govender 1,2 , Lerato ... levels of the precursor. In this letter, the formation of W 18 O 49 (= WO 2.72 ) and the effect of the laser power, the wavelength on the morphol...
Ngày tải lên : 21/06/2014, 05:20
  • 8
  • 272
  • 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... clearly separated by the proximity of the cells to the joint space and the bone respectively, alignment of the chondrocytes along the arcades of Benninghoff [29] and by the appearance of hypertrophic cells. ... differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene...
Ngày tải lên : 09/08/2014, 14:22
  • 15
  • 830
  • 0
Báo cáo y học: "Global fitness profiling of fission yeast deletion strains by barcode sequencing" pptx

Báo cáo y học: "Global fitness profiling of fission yeast deletion strains by barcode sequencing" pptx

... accurate barcode sequences in a hap- loid fission yeast deletion library and validated them by conducting fitness analysis of barcoded fission yeast dele- tion strains in pooled cultures. The barcode ... characterization of the barcode sequences in the deletion library and describe a fitness- profiling pipeline that allows the analysis of a fission yeast h...
Ngày tải lên : 09/08/2014, 20:22
  • 13
  • 442
  • 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx

Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx

... work is properly cited. Short report A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus Wei ... by wild-type and vaccine strains. In summary, the multiplex RT-nPCR developed in this study is a highly specific and sensitive assay for...
Ngày tải lên : 12/08/2014, 04:20
  • 6
  • 480
  • 0
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt

Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt

... Issue 6, Article R50 Research Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system Lyris MF de Godoy *† , Jesper V Olsen *† , Gustavo A de Souza *† , ... pairs. Yeast was SILAC labeled as explained in Figure 7 and one gel band was analyzed. In principle, SILAC peptide pairs should both be recognized and sequ...
Ngày tải lên : 14/08/2014, 16:21
  • 15
  • 267
  • 0
Báo cáo y học: "Chromatin Central: towards the comparative proteome by accurate mapping of the yeast proteomic environment" ppsx

Báo cáo y học: "Chromatin Central: towards the comparative proteome by accurate mapping of the yeast proteomic environment" ppsx

... accuracy [13]. Here we address the issue of proteomic accuracy by intense exploration of a section of the budding yeast proteome that is related to chromatin regulation. Chromatin is regulated by multiprotein ... 1. Genome Biology 2008, 9:R167 Open Access 2008Shevchenkoet al.Volume 9, Issue 11, Article R167 Research Chromatin Central: towards the comparative prote...
Ngày tải lên : 14/08/2014, 21:20
  • 22
  • 258
  • 0