party systems in post-soviet countries a comparative study of political institutionalization in the baltic states, russia and ukraine 2007

A comparative study of lexical cohesion in english and vietnamese newspaper articles

... a native of Egypt, was military leader of al Qaeda in Iraq.Al-Baghdadi was leader of the Islamic State of Iraq, an umbrella group that includes al Qaeda in Iraq.(CNN, April 25, 2010 Updated ... limited rate. Almost all of adjectives and adverbs in newspaper articles have neutral nuances of meaning and they are used to modify factual information rather than to express reports’ attitude and ... is included in that of the other (Hyponym). For example, one cannot say “an animal is a cat .” By contrast, it is accurate to say that a cat is an animal . ” That is, the meaning of animal“...

73
1,661
4

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... Methyl-glyoxal metabolism in assay buffer in the absence of cells wasalso measured (open diamonds). Data are ﬁtted to single exponen-tial ﬁts using equations in GRAFIT, and are the means of triplicatemeasurements.N. ... additionalhydrazone (the contaminant was not present in the unde-rivatized l-lactaldehyde preparation, or the 2,4-dinitro-phenylhydrazine reagent). The mass and retention time of the contaminating hydrazone ... UK The protozoan parasites Trypanosoma cruzi, Trypano-soma brucei and Leishmania spp. are the causativeagents of the human infections Chagas’ disease, sleep-ing sickness and leishmaniasis, respectively....

Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the ﬁsh species Seriola quinqueradiata pot

... Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the ﬁshspeciesSeriola quinqueradiataTamotsu ... yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns isattained in the presence of large amounts of docosahexa-enoic acid and that several acyltransferase activities ... Lysophospholipid acyltransferase systems of the yellowtail enable PtdIns to accumulate arachidonate in the presence of large amounts of docosahexaenoic acid and a limited supply of arachidonic acid. As PtdIns...

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... smok-ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy-sis by socioeconomic status. In ... validity study in Shanghai was conducted where the surviving spouse was the informant and both husband and wife had reported their smoking habits in the early 1980s.17 Information obtained ... in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991. As an example, we assessed the hazards of tobacco use on smoking-related cancer...

A comparative study of insults in vietnamese and american english

... 1 MINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG NGUYỄN XUÂN QUANG ... ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately. Second, the trends in each group of data for each social factor of age, as well as social ... 17 of them being male and another 15 being female. All of the 31 American respondents also aged from 30 to 40, with one half (16) being male and the other half (15) being female. 3.3. DATA ANALYSIS...

26
1,460
1

Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

... Regard-ing the Viterbi alignment in training, the baselineITG constraints yield a similar coverage as the IBMconstraints on the Verbmobil task. On the CanadianHansards task the baseline ITG constraints ... we adopt the view of the ITG constraints as a bilingual grammar as, e.g., in (Wu, 1997). For the baseline ITG constraints, the resulting grammar is: A → [AA] | AA | f/e | f/ | /eHere, [AA] ... on the Canadian Hansards task. This task contains the pro-ceedings of the Canadian parliament, which are keptby law in both French and English. About 3 millionparallel sentences of this bilingual...

A comparative study on rejecting invitation in English and Vietnamese

... but of affecting institutional states of affairs. They can do so in either of two ways. Some officially judge something to be the case, and others actually make something the case. Those of the ... the first kind include judges' rulings, referees' calls and assessors' appraisals, and the latter include sentencing, bequeathing and appointing. Acts of both kinds can be performed ... correlative attitude and in some cases to act in a certain way. For example, a statement expresses a belief and normally has the further purpose of getting the addressee form the same belief. A...

52
1,127
5

Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

... by Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of ... collaborators, in which the mean age was 41.08 and standard deviation was 14.32 years (Cruz et al., 2008). Silveira and collaborators observed similar results, obtaining a mean age of 49 years ... such as mediastinal and/ or hilar lymph nodes and in some cases, no radiographic alterations (Haramati and Jenny-Avital, 1998; Shah et al., 1997; Keiper et al., 1995; Naidich and McGuinness,...

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... (Amersham). The intensity of the proteinbands were quantiﬁed as absolute integrated optical densityusing labworks imaging and analysis software (UVP,UK). The resulting data were plotted against...

Xem thêm