party systems in post-soviet countries a comparative study of political institutionalization in the baltic states, russia and ukraine 2007

A comparative study of lexical cohesion in english and vietnamese newspaper articles

A comparative study of lexical cohesion in english and vietnamese newspaper articles

... a native of Egypt, was military leader of al Qaeda in Iraq. Al-Baghdadi was leader of the Islamic State of Iraq, an umbrella group that includes al Qaeda in Iraq. (CNN, April 25, 2010 Updated ... limited rate. Almost all of adjectives and adverbs in newspaper articles have neutral nuances of meaning and they are used to modify factual information rather than to ex...

Ngày tải lên: 14/12/2013, 00:40

73 1,7K 4
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... Methyl- glyoxal metabolism in assay buffer in the absence of cells was also measured (open diamonds). Data are fitted to single exponen- tial fits using equations in GRAFIT, and are the means of triplicate measurements. N. ... additional hydrazone (the contaminant was not present in the unde- rivatized l-lactaldehyde preparation, or the 2,4-dinitro- phenylhydrazine reagen...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

... Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata Tamotsu ... yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexa- enoic ac...

Ngày tải lên: 08/03/2014, 08:20

8 619 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... smok- ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy- sis by socioeconomic status. In ... validity study in Shanghai was conducted where the surviving spouse was the informant and both husband and wife had reported their smoking habits in the earl...

Ngày tải lên: 26/10/2012, 09:48

9 533 1
A comparative study of insults in vietnamese and american english

A comparative study of insults in vietnamese and american english

... 1 MINISTRY OF EDUCATION AND TRAINING MINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAINING MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG NGUYỄN XUÂN QUANG ... ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately. Second, the trends in each group of data for each social factor of...

Ngày tải lên: 26/11/2013, 13:16

26 1,5K 1
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

... Regard- ing the Viterbi alignment in training, the baseline ITG constraints yield a similar coverage as the IBM constraints on the Verbmobil task. On the Canadian Hansards task the baseline ITG constraints ... we adopt the view of the ITG constraints as a bilingual grammar as, e.g., in (Wu, 1997). For the baseline ITG constraints, the resulting grammar is: A →...

Ngày tải lên: 17/03/2014, 06:20

8 410 0
A comparative study on rejecting invitation in English and Vietnamese

A comparative study on rejecting invitation in English and Vietnamese

... but of affecting institutional states of affairs. They can do so in either of two ways. Some officially judge something to be the case, and others actually make something the case. Those of the ... the first kind include judges' rulings, referees' calls and assessors' appraisals, and the latter include sentencing, bequeathing and appointing. Acts...

Ngày tải lên: 18/03/2014, 00:21

52 1,1K 5
Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

... by Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of ... collaborators, in which the mean age was 41.08 and standard deviation was 14.32 years (Cruz et al., 2008). Silveira and collaborators observed similar results, obtai...

Ngày tải lên: 22/03/2014, 18:20

7 392 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGC...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
w