city of a million legends
city of a million legends
... she's another Balachandran." They all shuddered. Balachandran had been a high HP official and mastermind of an attempt to take over the galaxy by using a Wild Interface. "If this's ... stones are restorations. "Sirwini legend has it that this was the actual site of the City of a Million Legends. At least, there are about a million legends n...
Ngày tải lên: 30/05/2014, 23:00
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
... Val216 decides the substrate speci city of a- glucosidase in Saccharomyces cerevisiae Keizo Yamamoto 1 , Akifumi Nakayama 2 , Yuka Yamamoto 1, * and Shiro Tabata 1 1 Department of Chemistry, Nara ... Matsuura, Y., Kusunoki. M., Harada, W. & Kakudo, M. (19 84) Structure and possible catalytic residues of Taka-amylase A. J. Bi ochem. 95, 697 –702. 4. Nakajima, R., Imanaka, T. &...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... ¢- CGCTACAGCCTCCTACNNNAT CGAAGGTGCTTGG-3¢, w ith AAC and GAG as the mutated codons for Q39N and Q39E, respectively. For mutation at position E451, the primer sequence was 5¢- GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢,withGAC,CAAandTCA as ... Investigation of the substrate speci city of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Functional characterization and Me2+ ion specificity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf
... Microbiologı ´ a, Facultad de Ciencias Bioquı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Argentina Analysis of a large set of bacterial genomes has shown that, in spite of its high abundance ... of the family reveals that the three members associated with the fermentative citrate pathways of S. mutans, S. pyogenes and E. faecalis are on a separate branch of...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... tabacum UGT75C1 A. thaliana UGT75B1 A. thaliana UGT75D1 A. thaliana UGT84B1 A. thaliana UGT8 4A1 A. thaliana FaGT2 Fragariaxananassa UGT78D1 A. thaliana UGT8 6A1 A. thaliana UGT8 7A1 A. thaliana UGT8 3A1 ... A. thaliana UGT76C1 A. thaliana UGT71B1 A. thaliana CaUGT1 C. roseus UGT71C1 A. thaliana UGT71D2 A. thaliana UGT8 8A1 A. thaliana UGT72E2 A. thaliana UGT72E3 A. thaliana U...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada). All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada). Bacterial ... University of Guelph, Ontario, Canada Microbial degradation of aromatic compounds is important for maintaining the global carbon cycle and also for the bioremediation of man...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc
... S13 3A S13 3A- A CATCGACGCTCCCAGAGCATGGCCTGTCACGGTAAG S13 3A Y80V-S GCTCGATACTAACGTCACGCTCACGCCATTCG Y80V Y80S-S GCTCGATACTAACTCCACGCTCACGCCATTCG Y80S W260V-S GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC W260V W260V-V ... GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC W260V W260S-S GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC W260S W260S-V GCTTCTACTAGGAAGTACAAGCTCCGCTCGTCATC- W260S Table 4. Data collection and refinemen...
Ngày tải lên: 30/03/2014, 20:20
Tài liệu Effect of a school-based oral health education programme in Wuhan City, Peoples Republic of China ppt
... were calibrated against a master examiner. The kappa statistic was used to assess the inter-examiner reliability of caries and the final kappa scores were higher than 0.85 18 . Data on oral health ... use of oral health services, implementation of school- based oral health care programmes, adoption of regular self-care practices and use of fluoride tooth- paste 57 . Against this,...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf
... Councill of State for the Management of the Poste affaire Whereas John Teage who hath formerly beene actually in Armes for ye Parliam t and since that being an Inhabitant of this Citty hath beene ... coat -of- arms. A band of music with horns played several tunes adapted to the day, and a recruiting party drawn up before the doors with drums and fifes playing at intervals ha...
Ngày tải lên: 17/02/2014, 02:20