Treatment of enterococcus faecalis bacteria by a helium atmospheric cold plasma brush with oxygen addtion
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... cttgtacacaccgcccgtc Primer and Probe Sequence (5’-3’) Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT ... Toxicology and Water Quality., 13, 61-72. Park H. D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A. and Kato K. (2001). Degradation of the cyanobacterial hepatotoxin microcystin by...
Ngày tải lên: 05/09/2013, 10:15
DIRECT TREATMENT OF POLLUTED RIVER WATER BY THE MULTI-SOIL-LAYERING METHOD
... wastewater treatment (Luanmanee et al. 2001, Wakatsuki et al. 1993, 1998), cafeteria wastewater treatment (Attanandana et al. 2000) and laboratory scale experiments of high speed treatment at ... resources (Attanandana et al. 2000, Luanmanee et al. 2002). From these advantages, the MSL was appeared to be applicable for on-site treatment of wastewater from households, restaurants a...
Ngày tải lên: 05/09/2013, 08:40
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... 4-12-1 Nakanarusawa Hitachi, Ibaraki, 316-8511, JAPAN shinnou@lily, dse. ibaraki, ac. jp Abstract In this paper, we propose a practical method to detect Japanese homophone errors in Japanese ... problem by using various 1 '~' ~.,~. and '~.~ m~,' have a same phone 'i-sift'. The meaning of '~,' is a general will, and the meaning of &...
Ngày tải lên: 22/02/2014, 03:20
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx
... the walls of a glass test tube by solvent evaporation with a stream of nitrogen gas. Last traces of solvent were then removed by evaporation for 2 h under vacuum. Films were hydrated with a 10 ... Gambhir A, Hangyas-Mihalyne G, Zaitseva I, Cafiso DS, Wang J, Murray D, Pentyala SN, Smith SO & McLaughlin S (2004) Electrostatic sequestration of PIP2 on phospholipid memb...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... Oita, Japan Many natural catalytic antibodies have been discov- ered in the last decade. The first natural catalytic anti- body was isolated from the serum of an asthma patient [1], and this antibody ... antibodies exhibited catalytic activities as a whole antibody. A natural catalytic anti- body from the serum of hemophilia A patients repor- ted by Kaveri et al. was capable of d...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... Hartree– Fock (HF) and correlation parts, suggesting an attract- ive interaction of Nt with base pair A2 5-T8. The interaction of the NAE with A2 5 is very strong with substantial HF and correlation ... the DNA (seven contain an AATT tract and two contain a mixed ATAT tract). Only three structures, GDLB31 [9], GDL014 [11] and GDJ046 [12], are class I structures containing a CA...
Ngày tải lên: 16/03/2014, 22:20
preparation of fe2o3 submicro - flowers by a hydrothermal approach
... through a hydrothermal method using Span80 or L113B as a soft template [17]. Wan et al. have proposed a soft-template-assisted hydrothermal route to prepare single crystal nanorods with an average ... voltage increases, and the amplitude of the plateau is markedly reduced, so that only a discharge slope is observed, with a decrease in the discharge capacity. The initial discha...
Ngày tải lên: 20/03/2014, 13:06
Advances in the Treatment of Ischemic Stroke Edited by Maurizio Balestrino docx
... Guilherme Caldas Part 4 Treatment of Intracranial Hypertension 213 Chapter 12 Medical and Surgical Management of Intracranial Hypertension 215 James Scozzafava, Muhammad Shazam Hussain and Seby John ... Intravascular Cell Therapy in Stroke 141 Bhimashankar Mitkari, Erja Kerkelä, Johanna Nystedt, Matti Korhonen, Tuulia Huhtala and Jukka Jolkkonen Part 3 Intravenous Thrombolysis an...
Ngày tải lên: 23/03/2014, 17:20
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... absence and presence of an equimolar amount of a- crystallin. Images acquired at ·40 000 magnification show a higher level of suppression of j-casein fibrillation by a- crystallin at 50 °C than at ... interaction with a- crystallin, rather than any dissociation of the high-mass species. The interaction of a- crystallin with native j-casein appears to cause more structura...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: The histidine-phosphocarrier protein of Streptomyces coelicolor folds by a partially folded species at low pH ppt
... column. Fitting of the calculated erfc )1 (r) to the above equation by linear least-squares analysis was carried out with KALEIDA- GRAPH (Abelbeck software) working on a PC computer. Once the calibration parameters ... on a variety of carbon sources, such as cellulose and many monosaccharides and disaccha- rides. They are the source of approximately two-thirds of all natural a...
Ngày tải lên: 31/03/2014, 01:20