Treatment of enterococcus faecalis bacteria by a helium atmospheric cold plasma brush with oxygen addtion
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... cttgtacacaccgcccgtcPrimer and Probe Sequence (5’-3’) ReferenceMF gacccgatgttcaagatact Saito et al., 2003bMR ctcctcccacaaatcaggacQMF agacgcacgctcacctcaa in this studyQMR gagcagttcacgaaatccQMT ... Toxicology and Water Quality., 13, 61-72. Park H. D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A. and Kato K. (2001). Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium ... University of Agriculture Biofilm samples Samples of biofilm (10 g) were taken from a biological contact material, honeycomb catalyst, of a practical biological treatment facility a drinking water...
- 9
- 522
- 0
DIRECT TREATMENT OF POLLUTED RIVER WATER BY THE MULTI-SOIL-LAYERING METHOD
... wastewater treatment (Luanmanee et al. 2001, Wakatsuki et al. 1993, 1998),cafeteria wastewater treatment (Attanandana et al. 2000) and laboratory scale experiments of high speed treatment at ... resources (Attanandana et al. 2000, Luanmanee et al. 2002).From these advantages, the MSL was appeared to be applicable for on-site treatment of wastewater fromhouseholds, restaurants and so on in ... Wastewater (1995). 19th edn, American Public HealthAssociation/American Water Works Association/Water Environment Federation, Washington DC,USA.Attanandana T., Saitthiti B., Thongpae S., Kritapirom...
- 8
- 689
- 2
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... 4-12-1 Nakanarusawa Hitachi, Ibaraki, 316-8511, JAPAN shinnou@lily, dse. ibaraki, ac. jp Abstract In this paper, we propose a practical method to detect Japanese homophone errors in Japanese ... problem by using various 1 '~' ~.,~. and '~.~ m~,' have a same phone 'i-sift'. The meaning of '~,' is a general will, and the meaning of '~:~'.~.,, ... is a strong positive will. '~.~.' and '~' have a same phone 'cho-kkan'. The meaning of 'l-ff__,~. i is an intuition through a feeling, and the meaning of '~'...
- 8
- 588
- 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx
... thewalls of a glass test tube by solvent evaporation with a stream of nitrogen gas. Last traces of solvent were thenremoved by evaporation for 2 h under vacuum. Films werehydrated with a 10 ... Gambhir A, Hangyas-Mihalyne G, Zaitseva I, CafisoDS, Wang J, Murray D, Pentyala SN, Smith SO &McLaughlin S (2004) Electrostatic sequestration of PIP2on phospholipid membranes by basic ⁄ aromatic ... coefficient calculated from the aminoacid composition [43]. The solvent was rapidly evaporatedat 30 °C under a stream of nitrogen with constant rotation of a test tube to avoid separation of lipid components...
- 12
- 369
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... Oita, JapanMany natural catalytic antibodies have been discov-ered in the last decade. The first natural catalytic anti-body was isolated from the serum of an asthmapatient [1], and this antibody ... antibodies exhibited catalyticactivities as a whole antibody. A natural catalytic anti-body from the serum of hemophilia A patients repor-ted by Kaveri et al. was capable of digesting factorVIII molecule ... change. At 8 h of incubation (lane 3), the band of the b-subunit became very faint. Some new bands between bands 1 and 2 became clearer and severalbands around bands 4 and 5 also became darker....
- 9
- 388
- 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... Hartree–Fock (HF) and correlation parts, suggesting an attract-ive interaction of Nt with base pair A2 5-T8.The interaction of the NAE with A2 5 is verystrong with substantial HF and correlation ... the DNA (seven containan AATT tract and two contain a mixed ATAT tract).Only three structures, GDLB31 [9], GDL014 [11] andGDJ046 [12], are class I structures containing a CAATTG tract and are ... statisticsResolution range (A ˚) 9.6–1.75R-value 19.97No. of nonsolvent atoms 441No. of water molecules 68Average B-values of DNA (A ˚2)34.0Average B-values of Nt (A ˚2)35.4Average...
- 11
- 483
- 0
preparation of fe2o3 submicro - flowers by a hydrothermal approach
... through a hydrothermalmethod using Span80 or L113B as a soft template [17]. Wan etal. have proposed a soft-template-assisted hydrothermal routeto prepare single crystal nanorods with an average ... voltageincreases, and the amplitude of the plateau is markedly reduced,so that only a discharge slope is observed, with a decrease inthe discharge capacity. The initial discharge capacities of ... nanospheres with an average size of 20–30 nm. The electrochemical performance as anode material for lithium-ionbatteries was further evaluated by cyclic voltammetry (CV) and by electrochemical impedance...
- 6
- 382
- 0
Advances in the Treatment of Ischemic Stroke Edited by Maurizio Balestrino docx
... Guilherme Caldas Part 4 Treatment of Intracranial Hypertension 213 Chapter 12 Medical and Surgical Management of Intracranial Hypertension 215 James Scozzafava, Muhammad Shazam Hussain and Seby John ... Intravascular Cell Therapy in Stroke 141 Bhimashankar Mitkari, Erja Kerkelä, Johanna Nystedt, Matti Korhonen, Tuulia Huhtala and Jukka Jolkkonen Part 3 Intravenous Thrombolysis and Intra-Arterial ... Eduardo Nares-López, Gabriela Leticia González-Rivera and Mar a Elena Chánez-Cárdenas Chapter 3 Timing of Hypothermia (During or After Global Cerebral Ischemia) Differentially Affects Acute...
- 260
- 474
- 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... absence and presence of an equimolar amount of a- crystallin. Images acquired at ·40 000 magnification show a higher level of suppression of j-casein fibrillation by a- crystallin at50 °C than at ... interaction with a- crystallin, rather than any dissociation of thehigh-mass species. The interaction of a- crystallin with native j-casein appears to cause more structuralchanges than interaction with ... of amyloid fibril formation by a- crystallinTemperature dependence and the nature of the aggregating speciesAgata Rekas1,2, Lucy Jankova3, David C. Thorn4, Roberto Cappai5,6and John A. ...
- 16
- 577
- 0
Báo cáo khoa học: The histidine-phosphocarrier protein of Streptomyces coelicolor folds by a partially folded species at low pH ppt
... column.Fitting of the calculated erfc)1(r) to the above equation by linear least-squares analysis was carried out with KALEIDA-GRAPH(Abelbeck software) working on a PC computer.Once the calibration parameters ... on a variety of carbon sources,such as cellulose and many monosaccharides and disaccha-rides. They are the source of approximately two-thirds of allnatural antibiotics currently produced by ... of HPr at a final concentration of 5–6 mgÆmL)1were placed between a pair of CaF2windows separated by a 50-lm thick spacerin a Harrick Ossining demountable cell. Spectra wereacquired on a...
- 14
- 353
- 0
Từ khóa: continuous biotechnological treatment of cyanide contaminated waters by using a cyanide resistanan m part partition of n is represented by a sequenceskin management in treatment of severe pip contracture by homo or heterodigital flapsidentification of intrinsically disordered proteins by a special 2d electrophoresisebook the chemistry of food and nutrition by a w duncanreliability and evaluation of identification models exemplified by a histological diagnosis modethe role played by the characteristics of the template shared by a class of realizationsmodulating amyloid amp 946 levels by immunotherapy a potential therapeutic strategy for the prevention and treatment of alzheimer s diseasestrand breaksand oxidized purines pyrimidines induced by a simultaneous treatment of h2o2and vitamin c in the alkaline comet assay2 6 mosaic generation by ems treatment of tg β actin mgfp heterozygote zebrafish in a time course experiment the yellow arrows show the progress of cell migration along the base to tip axis the red arrows show the similar expression pattereach of which contain a transmembrane domain followed by a nucleotidebinding domainthe synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural genea computational treatment of sentencea general computational treatment of comparativesa uniform treatment of pragmatic inferences in simpleNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ